Incidental Mutation 'R4172:Akip1'
ID500493
Institutional Source Beutler Lab
Gene Symbol Akip1
Ensembl Gene ENSMUSG00000031023
Gene NameA kinase (PRKA) interacting protein 1
SynonymsORF27, BCA3, ICRFP703B1614Q5.6, D930014E17Rik, ICRFP703N2430Q5.6, D7H11orf17
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.392) question?
Stock #R4172 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location109703690-109712189 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 109707509 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 138 (Q138*)
Ref Sequence ENSEMBL: ENSMUSP00000033335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033334] [ENSMUST00000033335] [ENSMUST00000106735] [ENSMUST00000143581] [ENSMUST00000207745]
Predicted Effect probably benign
Transcript: ENSMUST00000033334
SMART Domains Protein: ENSMUSP00000033334
Gene: ENSMUSG00000031022

DomainStartEndE-ValueType
Pfam:DUF4537 85 225 1.1e-41 PFAM
low complexity region 258 284 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000033335
AA Change: Q138*
Predicted Effect probably benign
Transcript: ENSMUST00000106735
SMART Domains Protein: ENSMUSP00000102346
Gene: ENSMUSG00000031022

DomainStartEndE-ValueType
Pfam:DUF4537 85 225 6.3e-44 PFAM
low complexity region 258 284 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000143581
SMART Domains Protein: ENSMUSP00000115021
Gene: ENSMUSG00000031023

DomainStartEndE-ValueType
low complexity region 55 65 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207292
Predicted Effect probably benign
Transcript: ENSMUST00000207745
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with protein kinase A catalytic subunit, and regulates the effect of the cAMP-dependent protein kinase signaling pathway on the NF-kappa-B activation cascade. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdc5l A G 17: 45,419,772 I196T probably damaging Het
Dnah7b G T 1: 46,226,946 R2225L probably damaging Het
Gfra2 C A 14: 70,896,081 T117K possibly damaging Het
Gle1 T C 2: 29,938,526 I120T probably benign Het
Guf1 T A 5: 69,558,229 N52K possibly damaging Het
Helq T C 5: 100,771,847 K813E probably benign Het
Ighv7-4 A T 12: 114,223,015 F46I probably damaging Het
Il6st G A 13: 112,495,327 D467N probably benign Het
Jak1 C A 4: 101,159,132 V812L probably benign Het
Kank4 G T 4: 98,779,121 T363K probably damaging Het
Lcat C A 8: 105,942,427 W72L possibly damaging Het
Map2 T C 1: 66,413,600 S392P possibly damaging Het
Mtmr2 T C 9: 13,800,062 F456L probably damaging Het
Myh8 A T 11: 67,292,421 R709W probably damaging Het
Nop14 T C 5: 34,650,607 N337S probably damaging Het
Npbwr1 A G 1: 5,916,936 Y120H probably damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Oxsm A T 14: 16,242,079 V230E probably damaging Het
Paox G A 7: 140,134,028 G234R probably damaging Het
Polq C T 16: 37,060,758 H1095Y probably benign Het
Rad51c T C 11: 87,402,746 T77A probably damaging Het
Ryr3 C A 2: 112,794,470 V2202F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Snx27 T C 3: 94,503,487 H452R probably benign Het
Son C T 16: 91,659,362 H1666Y probably damaging Het
Spata25 C A 2: 164,827,488 W201L possibly damaging Het
Spint2 A G 7: 29,263,672 V67A probably damaging Het
Srgap1 T C 10: 121,855,363 Y322C probably benign Het
Synm T C 7: 67,735,361 Y409C probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpm1 T C 9: 67,023,367 N283D probably benign Het
Trpv6 T C 6: 41,625,498 D318G probably damaging Het
Ube2j2 A G 4: 155,949,086 D39G probably damaging Het
Ubr1 C T 2: 120,946,622 probably null Het
Vwa5a T C 9: 38,723,870 F224L probably damaging Het
Zfp445 T A 9: 122,851,937 M980L probably benign Het
Other mutations in Akip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Akip1 APN 7 109711838 missense probably damaging 1.00
R0024:Akip1 UTSW 7 109704138 missense probably benign 0.00
R0636:Akip1 UTSW 7 109707519 unclassified probably benign
R1872:Akip1 UTSW 7 109711775 missense probably damaging 1.00
R3861:Akip1 UTSW 7 109707406 unclassified probably benign
R4173:Akip1 UTSW 7 109707509 nonsense probably null
R4174:Akip1 UTSW 7 109707509 nonsense probably null
R4548:Akip1 UTSW 7 109704986 nonsense probably null
R4675:Akip1 UTSW 7 109708981 missense possibly damaging 0.95
R4687:Akip1 UTSW 7 109704986 nonsense probably null
R4965:Akip1 UTSW 7 109711754 missense probably damaging 0.99
R5867:Akip1 UTSW 7 109707477 missense probably benign 0.00
R6235:Akip1 UTSW 7 109707413 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGCACAAGTATCGTAGTCTG -3'
(R):5'- TCCAGGAGAACAGGTTCAACTG -3'

Sequencing Primer
(F):5'- ATCGTAGTCTGAAATTTTGGCCAG -3'
(R):5'- ACAGGTTCAACTGAAGATCCTAG -3'
Posted On2017-12-01