Incidental Mutation 'R4246:Tsen2'
ID500514
Institutional Source Beutler Lab
Gene Symbol Tsen2
Ensembl Gene ENSMUSG00000042389
Gene NametRNA splicing endonuclease subunit 2
Synonyms
MMRRC Submission 041062-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R4246 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location115544664-115578628 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 115547824 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040234] [ENSMUST00000130425]
Predicted Effect probably benign
Transcript: ENSMUST00000040234
SMART Domains Protein: ENSMUSP00000038211
Gene: ENSMUSG00000042389

DomainStartEndE-ValueType
Blast:HOLI 1 55 2e-23 BLAST
Pfam:tRNA_int_endo_N 258 324 9.9e-16 PFAM
Pfam:tRNA_int_endo 334 426 5.2e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123359
Predicted Effect probably benign
Transcript: ENSMUST00000130425
SMART Domains Protein: ENSMUSP00000145431
Gene: ENSMUSG00000042389

DomainStartEndE-ValueType
Blast:HOLI 1 55 3e-26 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138200
Meta Mutation Damage Score 0.0692 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the tRNA splicing endonuclease. This endonuclease catalyzes the first step in RNA splicing which is the removal of introns. Mutations in this gene have been associated with pontocerebellar hypoplasia type 2. A pseudogene has been identified on chromosome 4. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
Ak1 A G 2: 32,633,372 T151A possibly damaging Het
Asxl3 A G 18: 22,525,500 D2189G probably damaging Het
Ccdc91 C T 6: 147,592,148 A346V unknown Het
Dnah6 C T 6: 73,129,448 E1769K probably benign Het
Dock6 A T 9: 21,839,490 probably null Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Glyatl3 T A 17: 40,910,098 D126V probably benign Het
Gm15922 C T 7: 3,737,349 G291E probably damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Igkv8-21 T A 6: 70,315,452 M1L possibly damaging Het
Itih4 C A 14: 30,891,402 H261N probably damaging Het
Jpt1 T C 11: 115,514,293 probably benign Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Klhl32 A C 4: 24,800,822 S3A possibly damaging Het
Kmt2d C T 15: 98,840,089 probably benign Het
Lamtor5 T C 3: 107,279,038 V41A probably benign Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrfn1 G T 7: 28,459,942 V429L probably benign Het
Mapkbp1 T A 2: 120,013,027 I252N probably damaging Het
Nelfa A G 5: 33,899,029 F464S probably damaging Het
Nipbl G A 15: 8,332,432 L1454F probably damaging Het
Nr4a3 C T 4: 48,083,125 P553S possibly damaging Het
Nrg3 G A 14: 39,472,241 T187I possibly damaging Het
Olfr1030 T A 2: 85,984,280 C147S possibly damaging Het
Olfr957 A G 9: 39,511,603 V39A probably benign Het
Pcdha8 A G 18: 36,992,897 E144G probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ppp1r3a T A 6: 14,719,781 E378V probably damaging Het
Psd2 T C 18: 36,006,119 L540P probably damaging Het
Rnf14 T A 18: 38,301,648 probably null Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3d19 G A 3: 86,126,688 V783I probably benign Het
Snca T C 6: 60,733,165 E110G possibly damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Trhr A T 15: 44,233,460 probably null Het
Tuft1 C A 3: 94,614,801 M319I probably benign Het
Vill C A 9: 119,060,393 N132K probably damaging Het
Wars2 T A 3: 99,216,588 V255E probably damaging Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Other mutations in Tsen2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Tsen2 APN 6 115576984 missense probably damaging 1.00
IGL01409:Tsen2 APN 6 115559594 missense possibly damaging 0.72
IGL02002:Tsen2 APN 6 115559607 missense probably benign 0.12
IGL03301:Tsen2 APN 6 115568771 missense probably damaging 1.00
FR4304:Tsen2 UTSW 6 115560069 small insertion probably benign
FR4340:Tsen2 UTSW 6 115560066 small insertion probably benign
FR4340:Tsen2 UTSW 6 115560069 small insertion probably benign
FR4342:Tsen2 UTSW 6 115560072 small insertion probably benign
FR4548:Tsen2 UTSW 6 115560068 small insertion probably benign
FR4737:Tsen2 UTSW 6 115560077 small insertion probably benign
FR4976:Tsen2 UTSW 6 115560066 small insertion probably benign
R0141:Tsen2 UTSW 6 115568829 missense probably damaging 0.99
R1165:Tsen2 UTSW 6 115561435 missense probably damaging 1.00
R1528:Tsen2 UTSW 6 115560028 missense probably benign 0.01
R2152:Tsen2 UTSW 6 115547975 missense possibly damaging 0.94
R4022:Tsen2 UTSW 6 115547987 missense probably damaging 1.00
R4247:Tsen2 UTSW 6 115547824 splice site probably benign
R4249:Tsen2 UTSW 6 115547824 splice site probably benign
R4774:Tsen2 UTSW 6 115575933 missense possibly damaging 0.92
R5511:Tsen2 UTSW 6 115561404 missense probably damaging 1.00
R5580:Tsen2 UTSW 6 115577980 missense probably damaging 1.00
R5935:Tsen2 UTSW 6 115559595 missense probably damaging 1.00
R6086:Tsen2 UTSW 6 115560075 missense probably benign 0.35
R6457:Tsen2 UTSW 6 115559631 missense probably benign 0.01
R6750:Tsen2 UTSW 6 115549920 missense probably damaging 1.00
R7009:Tsen2 UTSW 6 115547972 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGTTAAGGTGATGGCACTGGC -3'
(R):5'- GGCTTACCTTCCCATACAGCTG -3'

Sequencing Primer
(F):5'- ACTGGCTTCTTAGAGGTCTTAGCATC -3'
(R):5'- CCCATACAGCTGCTCCATG -3'
Posted On2017-12-01