Incidental Mutation 'R4249:Tsen2'
ID500516
Institutional Source Beutler Lab
Gene Symbol Tsen2
Ensembl Gene ENSMUSG00000042389
Gene NametRNA splicing endonuclease subunit 2
Synonyms
MMRRC Submission 041065-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R4249 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location115544664-115578628 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 115547824 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040234] [ENSMUST00000130425]
Predicted Effect probably benign
Transcript: ENSMUST00000040234
SMART Domains Protein: ENSMUSP00000038211
Gene: ENSMUSG00000042389

DomainStartEndE-ValueType
Blast:HOLI 1 55 2e-23 BLAST
Pfam:tRNA_int_endo_N 258 324 9.9e-16 PFAM
Pfam:tRNA_int_endo 334 426 5.2e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123359
Predicted Effect probably benign
Transcript: ENSMUST00000130425
SMART Domains Protein: ENSMUSP00000145431
Gene: ENSMUSG00000042389

DomainStartEndE-ValueType
Blast:HOLI 1 55 3e-26 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138200
Meta Mutation Damage Score 0.0692 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the tRNA splicing endonuclease. This endonuclease catalyzes the first step in RNA splicing which is the removal of introns. Mutations in this gene have been associated with pontocerebellar hypoplasia type 2. A pseudogene has been identified on chromosome 4. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
Ankrd39 A G 1: 36,547,155 S11P probably benign Het
Aox2 A G 1: 58,299,819 S324G probably benign Het
Atl3 T C 19: 7,532,338 V477A probably benign Het
Bcar1 T C 8: 111,720,893 T151A probably benign Het
Cdc42bpg A G 19: 6,315,266 T718A possibly damaging Het
Col9a1 C T 1: 24,244,381 R843C probably damaging Het
Dnah12 T A 14: 26,709,186 D316E possibly damaging Het
Fat2 A G 11: 55,284,301 V1862A probably damaging Het
Fbxw5 C A 2: 25,503,460 N233K probably damaging Het
Fcer2a A G 8: 3,688,831 F75L probably benign Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Gimd1 T C 3: 132,644,408 V144A possibly damaging Het
Glt1d1 T C 5: 127,691,112 probably null Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Kansl1l C T 1: 66,773,478 D459N probably damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Muc4 T C 16: 32,755,826 probably benign Het
Myom1 T A 17: 71,092,140 V999E probably damaging Het
Nckap5 A G 1: 126,027,639 L460P probably benign Het
Olfr109 T C 17: 37,466,824 M206T probably damaging Het
Phf13 A T 4: 151,992,095 N213K probably damaging Het
Phldb3 T C 7: 24,627,320 I591T probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Plekhh2 A G 17: 84,586,337 E860G possibly damaging Het
Rest A G 5: 77,282,112 T793A probably benign Het
Ropn1 C T 16: 34,678,456 Q205* probably null Het
Sacs A C 14: 61,203,457 K984T probably benign Het
Samd11 G A 4: 156,250,486 R102C probably damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Shank1 C A 7: 44,319,736 H352N unknown Het
Slc22a27 A T 19: 7,925,879 I162K possibly damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Tln1 A T 4: 43,536,104 V2027E probably damaging Het
Trdn A G 10: 33,450,998 I594M probably benign Het
Trim5 C G 7: 104,276,815 E180Q possibly damaging Het
Tubb1 A T 2: 174,455,733 E45V probably null Het
Vmn2r67 T A 7: 85,150,514 probably null Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Zfp160 T A 17: 21,025,738 F183L probably benign Het
Other mutations in Tsen2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Tsen2 APN 6 115576984 missense probably damaging 1.00
IGL01409:Tsen2 APN 6 115559594 missense possibly damaging 0.72
IGL02002:Tsen2 APN 6 115559607 missense probably benign 0.12
IGL03301:Tsen2 APN 6 115568771 missense probably damaging 1.00
FR4304:Tsen2 UTSW 6 115560069 small insertion probably benign
FR4340:Tsen2 UTSW 6 115560066 small insertion probably benign
FR4340:Tsen2 UTSW 6 115560069 small insertion probably benign
FR4342:Tsen2 UTSW 6 115560072 small insertion probably benign
FR4548:Tsen2 UTSW 6 115560068 small insertion probably benign
FR4737:Tsen2 UTSW 6 115560077 small insertion probably benign
FR4976:Tsen2 UTSW 6 115560066 small insertion probably benign
R0141:Tsen2 UTSW 6 115568829 missense probably damaging 0.99
R1165:Tsen2 UTSW 6 115561435 missense probably damaging 1.00
R1528:Tsen2 UTSW 6 115560028 missense probably benign 0.01
R2152:Tsen2 UTSW 6 115547975 missense possibly damaging 0.94
R4022:Tsen2 UTSW 6 115547987 missense probably damaging 1.00
R4246:Tsen2 UTSW 6 115547824 splice site probably benign
R4247:Tsen2 UTSW 6 115547824 splice site probably benign
R4774:Tsen2 UTSW 6 115575933 missense possibly damaging 0.92
R5511:Tsen2 UTSW 6 115561404 missense probably damaging 1.00
R5580:Tsen2 UTSW 6 115577980 missense probably damaging 1.00
R5935:Tsen2 UTSW 6 115559595 missense probably damaging 1.00
R6086:Tsen2 UTSW 6 115560075 missense probably benign 0.35
R6457:Tsen2 UTSW 6 115559631 missense probably benign 0.01
R6750:Tsen2 UTSW 6 115549920 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTAAGGTGATGGCACTGGC -3'
(R):5'- GGCTTACCTTCCCATACAGCTG -3'

Sequencing Primer
(F):5'- ACTGGCTTCTTAGAGGTCTTAGCATC -3'
(R):5'- CCCATACAGCTGCTCCATG -3'
Posted On2017-12-01