Incidental Mutation 'R4296:Tecrl'
ID500530
Institutional Source Beutler Lab
Gene Symbol Tecrl
Ensembl Gene ENSMUSG00000049537
Gene Nametrans-2,3-enoyl-CoA reductase-like
SynonymsSrd5a2l2, D330017N19Rik
MMRRC Submission 041656-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R4296 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location83278145-83355195 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 83313327 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 79 (C79*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053543]
Predicted Effect probably null
Transcript: ENSMUST00000053543
AA Change: C94*
SMART Domains Protein: ENSMUSP00000062122
Gene: ENSMUSG00000049537
AA Change: C94*

DomainStartEndE-ValueType
PDB:2DZJ|A 53 135 1e-17 PDB
Blast:UBQ 59 135 2e-7 BLAST
transmembrane domain 139 161 N/A INTRINSIC
Pfam:Steroid_dh 208 361 3.8e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146669
AA Change: C79*
SMART Domains Protein: ENSMUSP00000115144
Gene: ENSMUSG00000049537
AA Change: C79*

DomainStartEndE-ValueType
PDB:2DZJ|A 39 93 1e-11 PDB
transmembrane domain 100 122 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G T 19: 43,823,074 G993C probably damaging Het
Abcc2 G C 19: 43,823,075 G993A probably damaging Het
Abi3bp A T 16: 56,668,310 H810L probably benign Het
Aldh1l2 T C 10: 83,522,777 D5G probably benign Het
Aldh7a1 A T 18: 56,544,963 probably null Het
Aox1 T A 1: 58,057,400 probably null Het
Apbb1 G T 7: 105,573,826 Q193K probably benign Het
Arl9 C A 5: 77,006,549 N41K probably damaging Het
Armc1 A G 3: 19,149,516 M82T probably damaging Het
Bms1 T C 6: 118,404,999 E526G probably damaging Het
Cacna1a C T 8: 84,559,293 R809C probably damaging Het
Cd200r1 T C 16: 44,789,670 I84T probably damaging Het
Cgrrf1 T C 14: 46,832,355 V27A probably damaging Het
Clec4f G A 6: 83,652,575 Q334* probably null Het
Cpeb3 C T 19: 37,173,989 G329D possibly damaging Het
Ctnnbl1 C T 2: 157,819,570 probably null Het
Dip2b A T 15: 100,181,336 M810L probably benign Het
Eml3 T C 19: 8,931,409 S158P probably damaging Het
Eps8l2 G T 7: 141,358,262 E470* probably null Het
Flt3l A G 7: 45,134,004 F146S probably damaging Het
Glmn A T 5: 107,558,502 V419E possibly damaging Het
Gm11360 T A 13: 27,956,312 I53N probably damaging Het
Gpbp1l1 T A 4: 116,587,459 V275D possibly damaging Het
Harbi1 T A 2: 91,712,755 M187K possibly damaging Het
Has3 T C 8: 106,878,422 V420A possibly damaging Het
Huwe1 C A X: 151,888,448 T1012K probably benign Het
Iqcg G A 16: 33,016,975 probably benign Het
Itga4 G A 2: 79,272,799 G111R probably damaging Het
Keap1 A G 9: 21,233,986 S243P probably damaging Het
Kmt2a C T 9: 44,821,175 probably benign Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Ltbp3 A T 19: 5,756,582 probably null Het
Mbtps1 C T 8: 119,522,499 C684Y possibly damaging Het
Mcm3ap A T 10: 76,507,337 I1688F probably damaging Het
Midn C T 10: 80,151,719 T21I probably damaging Het
Naf1 C T 8: 66,889,462 P580S possibly damaging Het
Nlrp3 A T 11: 59,549,661 E688V possibly damaging Het
Nusap1 A G 2: 119,639,648 H259R probably damaging Het
Nxpe4 A G 9: 48,398,984 T516A probably damaging Het
Oas1g T A 5: 120,879,167 T275S probably damaging Het
Ogdh T G 11: 6,349,374 F743V probably damaging Het
Olfr1109 T C 2: 87,092,630 T256A probably benign Het
Olfr1505 A G 19: 13,919,353 E111G probably damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr790 C A 10: 129,501,470 C195* probably null Het
Olfr811 C A 10: 129,802,300 C75F probably damaging Het
Pdzd3 G A 9: 44,248,861 R349C probably benign Het
Peg10 GGAT GGATCCCCATCATGAT 6: 4,756,472 probably benign Het
Piezo1 T A 8: 122,491,127 Y819F probably damaging Het
Plekhg2 C A 7: 28,371,166 G20C probably damaging Het
Polq A G 16: 37,061,301 T997A possibly damaging Het
Polr3a T A 14: 24,453,196 Q1190L possibly damaging Het
Ppp1r15a T A 7: 45,523,749 K800* probably null Het
Prkdc T A 16: 15,737,905 M2181K probably damaging Het
Pskh1 C A 8: 105,912,904 A72E probably benign Het
Purg T C 8: 33,387,293 Y320H probably damaging Het
Rab3gap2 T A 1: 185,255,837 probably null Het
Rnps1 T A 17: 24,425,115 probably benign Het
Scgb2b21 A T 7: 33,519,808 V57E probably benign Het
Sdhaf2 A T 19: 10,525,075 I7N probably benign Het
Six4 A G 12: 73,104,125 Y549H probably damaging Het
Slc4a10 G T 2: 62,234,428 V209F possibly damaging Het
Slc4a11 C A 2: 130,685,007 V734F probably benign Het
Stk4 T A 2: 164,117,984 M27K possibly damaging Het
Tgm3 G T 2: 130,038,413 V380L possibly damaging Het
Tiam2 A T 17: 3,450,845 M920L probably benign Het
Tjp1 T C 7: 65,318,489 N729S probably damaging Het
Tlr12 A G 4: 128,617,788 L223P probably damaging Het
Tmem268 T C 4: 63,565,768 probably null Het
Tmpo A T 10: 91,162,956 I323K possibly damaging Het
Tmx4 T C 2: 134,598,629 S302G probably benign Het
Trip11 C A 12: 101,885,868 E361* probably null Het
Tspyl3 T A 2: 153,225,156 N54I possibly damaging Het
Upp2 A T 2: 58,778,009 Y220F probably damaging Het
Usp22 G T 11: 61,161,464 probably null Het
Vezt ACTCCTCCT ACTCCT 10: 93,973,931 probably benign Het
Vmn1r235 G T 17: 21,262,300 G296W probably damaging Het
Vmn1r89 T C 7: 13,220,186 V94A possibly damaging Het
Zfp607a A T 7: 27,865,648 E80V probably damaging Het
Other mutations in Tecrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Tecrl APN 5 83294606 missense probably benign
IGL02067:Tecrl APN 5 83284275 missense probably benign 0.05
IGL02111:Tecrl APN 5 83354792 missense probably damaging 1.00
IGL02391:Tecrl APN 5 83354827 missense probably benign 0.00
IGL02860:Tecrl APN 5 83354997 missense probably benign 0.01
IGL03079:Tecrl APN 5 83294600 missense probably damaging 0.96
IGL03109:Tecrl APN 5 83309309 intron probably benign
R0095:Tecrl UTSW 5 83294570 splice site probably benign
R0347:Tecrl UTSW 5 83294632 missense probably damaging 1.00
R0372:Tecrl UTSW 5 83294659 missense probably damaging 1.00
R0403:Tecrl UTSW 5 83354758 splice site probably benign
R0426:Tecrl UTSW 5 83354763 splice site probably benign
R0597:Tecrl UTSW 5 83354928 nonsense probably null
R1607:Tecrl UTSW 5 83280508 splice site probably null
R1771:Tecrl UTSW 5 83291287 missense probably damaging 1.00
R1800:Tecrl UTSW 5 83279230 missense probably damaging 1.00
R1815:Tecrl UTSW 5 83279234 missense probably benign 0.01
R1869:Tecrl UTSW 5 83354859 missense probably benign 0.00
R1870:Tecrl UTSW 5 83354859 missense probably benign 0.00
R4471:Tecrl UTSW 5 83313287 missense probably benign
R6281:Tecrl UTSW 5 83294606 missense probably damaging 1.00
R6343:Tecrl UTSW 5 83294600 missense probably damaging 0.96
R6866:Tecrl UTSW 5 83313314 missense probably damaging 1.00
R6948:Tecrl UTSW 5 83309250 missense probably benign
R6971:Tecrl UTSW 5 83354802 missense possibly damaging 0.58
R6981:Tecrl UTSW 5 83354921 missense possibly damaging 0.83
R7246:Tecrl UTSW 5 83279335 missense probably damaging 0.99
R7282:Tecrl UTSW 5 83354907 missense probably benign 0.26
X0019:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0024:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0034:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0035:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0036:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0037:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0038:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0039:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0040:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0052:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0053:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0054:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0058:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0060:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0061:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0062:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0063:Tecrl UTSW 5 83338252 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- CTGCTAGAGAATGTTGCATTTTCC -3'
(R):5'- GTAGCAGTTTCATCCAATAACCAC -3'

Sequencing Primer
(F):5'- GAATGTTGCATTTTCCCCAAATTTC -3'
(R):5'- ACCCTCCACTGCTAGTCAGC -3'
Posted On2017-12-01