Incidental Mutation 'R4334:Igsf9'
ID500583
Institutional Source Beutler Lab
Gene Symbol Igsf9
Ensembl Gene ENSMUSG00000037995
Gene Nameimmunoglobulin superfamily, member 9
SynonymsNRT1, Dasm1
MMRRC Submission 041664-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4334 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location172481788-172498878 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 172494212 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 149 (K149*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052629] [ENSMUST00000111235] [ENSMUST00000127052] [ENSMUST00000127482] [ENSMUST00000135267]
Predicted Effect probably null
Transcript: ENSMUST00000052629
AA Change: K454*
SMART Domains Protein: ENSMUSP00000058275
Gene: ENSMUSG00000037995
AA Change: K454*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 131 6.81e-6 SMART
IGc2 149 213 4.92e-12 SMART
IG 233 320 8.64e-8 SMART
IG_like 329 412 4.3e1 SMART
IGc2 431 493 9.12e-7 SMART
FN3 508 593 1.82e-4 SMART
FN3 624 705 7.01e-6 SMART
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
low complexity region 909 930 N/A INTRINSIC
low complexity region 942 953 N/A INTRINSIC
low complexity region 1143 1165 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111235
AA Change: K454*
SMART Domains Protein: ENSMUSP00000106866
Gene: ENSMUSG00000037995
AA Change: K454*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 131 6.81e-6 SMART
IGc2 149 213 4.92e-12 SMART
IG 233 320 8.64e-8 SMART
IG_like 329 412 4.3e1 SMART
IGc2 431 493 9.12e-7 SMART
FN3 508 593 1.82e-4 SMART
FN3 624 705 7.01e-6 SMART
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
low complexity region 909 930 N/A INTRINSIC
low complexity region 942 953 N/A INTRINSIC
low complexity region 1143 1165 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125258
Predicted Effect probably benign
Transcript: ENSMUST00000127052
SMART Domains Protein: ENSMUSP00000123401
Gene: ENSMUSG00000037995

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Blast:IG 26 109 6e-55 BLAST
SCOP:d1biha2 28 108 6e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127482
AA Change: K454*
SMART Domains Protein: ENSMUSP00000117854
Gene: ENSMUSG00000037995
AA Change: K454*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 131 6.81e-6 SMART
IGc2 149 213 4.92e-12 SMART
IG 233 320 8.64e-8 SMART
IG_like 329 412 4.3e1 SMART
IGc2 431 493 9.12e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132141
Predicted Effect probably benign
Transcript: ENSMUST00000135267
SMART Domains Protein: ENSMUSP00000116948
Gene: ENSMUSG00000037995

DomainStartEndE-ValueType
IG_like 4 68 3.29e1 SMART
IGc2 86 148 3.03e-12 SMART
low complexity region 156 168 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155426
Predicted Effect probably null
Transcript: ENSMUST00000193620
AA Change: K149*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile but show abnormal miniature inhibitory postsynaptic currents and increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,318,268 V447E probably damaging Het
Adcyap1 T C 17: 93,202,268 L49P probably benign Het
B4galt4 T C 16: 38,752,259 I102T probably damaging Het
Cc2d2a A G 5: 43,683,134 D110G probably benign Het
Ccdc141 C T 2: 77,170,432 V19I probably damaging Het
Ccdc39 A G 3: 33,837,882 L147P probably damaging Het
Cdc5l A T 17: 45,410,786 D519E probably benign Het
Cdh23 G T 10: 60,385,059 T1305K probably damaging Het
Cfi T A 3: 129,850,829 V158D possibly damaging Het
Clstn2 T G 9: 97,463,528 Y589S probably damaging Het
Dsp A G 13: 38,196,664 K1863E possibly damaging Het
Enpp3 A T 10: 24,793,589 M491K probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fkbp15 G A 4: 62,303,219 A1170V possibly damaging Het
Foxa2 T C 2: 148,044,703 N64S possibly damaging Het
Foxm1 T C 6: 128,365,967 I88T probably damaging Het
Gm3173 A T 14: 4,514,779 I8L possibly damaging Het
Gpatch3 A G 4: 133,582,481 D375G probably damaging Het
Herc2 T C 7: 56,226,654 F4436L probably damaging Het
Htr3b G A 9: 48,945,509 A223V probably damaging Het
Iars2 T A 1: 185,303,394 T550S probably benign Het
Khnyn A G 14: 55,894,042 D536G probably damaging Het
Kng1 T C 16: 23,079,620 V409A possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Madd C T 2: 91,140,572 V1508I probably benign Het
Micall2 T C 5: 139,713,350 E527G probably damaging Het
Myo7b A G 18: 31,976,987 S1141P probably damaging Het
Ncoa2 G A 1: 13,174,963 P504S possibly damaging Het
Notch1 G A 2: 26,460,036 T2364I probably benign Het
Pde4c T A 8: 70,749,826 probably null Het
Pik3cb A G 9: 99,061,851 L633P probably damaging Het
Ranbp2 T A 10: 58,463,994 D483E probably damaging Het
Sh3tc2 A G 18: 61,990,321 N718D probably damaging Het
Spast G A 17: 74,352,015 A126T probably damaging Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Tmprss6 T A 15: 78,459,427 probably null Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc79 C T 12: 103,078,974 T803M probably benign Het
Vmn2r118 A T 17: 55,610,347 F388L possibly damaging Het
Vmn2r71 T C 7: 85,619,834 V415A probably benign Het
Wdr4 A T 17: 31,499,152 F316Y possibly damaging Het
Zfp810 T C 9: 22,278,784 Y276C probably benign Het
Other mutations in Igsf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Igsf9 APN 1 172496636 missense probably benign
IGL01665:Igsf9 APN 1 172492171 nonsense probably null
IGL01808:Igsf9 APN 1 172484803 missense probably benign 0.03
IGL02480:Igsf9 APN 1 172496913 missense possibly damaging 0.88
IGL02480:Igsf9 APN 1 172484778 intron probably benign
IGL03087:Igsf9 APN 1 172490743 missense probably benign 0.00
R1258:Igsf9 UTSW 1 172492155 missense probably benign 0.02
R1419:Igsf9 UTSW 1 172498011 missense probably damaging 1.00
R2246:Igsf9 UTSW 1 172491649 missense probably benign 0.21
R2427:Igsf9 UTSW 1 172490739 missense probably damaging 0.98
R3900:Igsf9 UTSW 1 172489558 missense probably damaging 1.00
R4831:Igsf9 UTSW 1 172491888 missense probably damaging 1.00
R4844:Igsf9 UTSW 1 172497170 missense probably benign 0.00
R4894:Igsf9 UTSW 1 172498067 missense probably benign 0.00
R5016:Igsf9 UTSW 1 172490712 missense probably damaging 1.00
R5358:Igsf9 UTSW 1 172484511 missense probably benign 0.01
R5705:Igsf9 UTSW 1 172494771 missense possibly damaging 0.80
R5762:Igsf9 UTSW 1 172498438 missense probably damaging 1.00
R6058:Igsf9 UTSW 1 172484889 missense probably damaging 1.00
R6510:Igsf9 UTSW 1 172490297 missense possibly damaging 0.78
R6821:Igsf9 UTSW 1 172484493 missense probably benign 0.39
R6822:Igsf9 UTSW 1 172497163 missense possibly damaging 0.95
R6829:Igsf9 UTSW 1 172495674 missense probably benign
R6848:Igsf9 UTSW 1 172495762 missense probably damaging 1.00
R6874:Igsf9 UTSW 1 172494529 missense probably benign
R7224:Igsf9 UTSW 1 172494782 missense probably damaging 1.00
R7284:Igsf9 UTSW 1 172496912 missense probably damaging 0.99
R7292:Igsf9 UTSW 1 172491757 critical splice donor site probably null
R7409:Igsf9 UTSW 1 172495274 missense probably benign
V7732:Igsf9 UTSW 1 172490393 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GACTAAGACATTATGACAGGCAC -3'
(R):5'- AGGCTGTTGTTGCTGTCCAC -3'

Sequencing Primer
(F):5'- CAGGCACCTGGGAATGG -3'
(R):5'- TGGTCAGCCCTGAAGACACAG -3'
Posted On2017-12-01