Incidental Mutation 'R4363:Vmn2r-ps69'
ID500584
Institutional Source Beutler Lab
Gene Symbol Vmn2r-ps69
Ensembl Gene ENSMUSG00000090773
Gene Namevomeronasal 2, receptor, pseudogene 69
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R4363 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location85303953-85342891 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) T to C at 85310492 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173382
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,270,745 S3179T unknown Het
9530053A07Rik T C 7: 28,146,906 S1008P probably damaging Het
Abcc2 G T 19: 43,799,136 W207L possibly damaging Het
Adamts13 G A 2: 27,004,782 C1034Y probably damaging Het
Adgrb3 A T 1: 25,112,222 V1081E probably damaging Het
Apcdd1 T A 18: 62,951,932 I400N possibly damaging Het
Bcan G T 3: 87,997,098 T117K probably damaging Het
Bicc1 ATGTG ATG 10: 70,943,374 probably null Het
Cmtr1 T C 17: 29,674,232 L75P probably damaging Het
Cplx2 A T 13: 54,378,817 T13S probably benign Het
Drd3 A T 16: 43,762,359 I72F probably damaging Het
Dsn1 A T 2: 156,999,142 I214K probably benign Het
Ermp1 A T 19: 29,612,876 W809R probably damaging Het
Fam105a C T 15: 27,664,343 probably null Het
Fbn2 G A 18: 58,149,050 S298L probably damaging Het
Fbxo33 T C 12: 59,204,862 H289R probably damaging Het
Gli2 T C 1: 118,853,370 N189S probably benign Het
Hus1 G T 11: 8,998,676 L242I probably damaging Het
Hyou1 G A 9: 44,380,615 probably null Het
Kirrel C A 3: 87,090,485 E244* probably null Het
Mmrn2 C T 14: 34,397,977 A268V probably damaging Het
Mycbp2 G T 14: 103,248,457 A1023E probably damaging Het
Nedd9 A T 13: 41,317,953 I184N probably damaging Het
Nmnat1 T C 4: 149,473,445 I47V probably benign Het
Olfr339 A T 2: 36,421,532 I45F probably damaging Het
Olfr561 T C 7: 102,775,256 V244A probably benign Het
Pak1 T C 7: 97,883,586 S198P possibly damaging Het
Pank1 A C 19: 34,827,132 V208G probably damaging Het
Pcdhga12 C G 18: 37,766,161 F15L probably benign Het
Recql4 T C 15: 76,706,044 D723G probably benign Het
Rgs22 A T 15: 36,103,874 I147N probably damaging Het
Selenbp1 A G 3: 94,942,749 probably null Het
Sspo A G 6: 48,498,731 Y4927C probably damaging Het
Syk A T 13: 52,640,730 H477L probably damaging Het
Tnfrsf11b T A 15: 54,256,159 T140S possibly damaging Het
Other mutations in Vmn2r-ps69
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1462:Vmn2r-ps69 UTSW 7 85310352 splice site noncoding transcript
R2886:Vmn2r-ps69 UTSW 7 85307624 critical splice donor site noncoding transcript
R4820:Vmn2r-ps69 UTSW 7 85310376 exon noncoding transcript
R5761:Vmn2r-ps69 UTSW 7 85304015 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- AAGGTCTTTCAGTGAATCTCTGTTG -3'
(R):5'- TGTTCTCAGGCTCTAGAATAAGG -3'

Sequencing Primer
(F):5'- GGCCTAGAATTCAGAAATCTGCCTG -3'
(R):5'- TTCCTTTCTGCAAAAGACT -3'
Posted On2017-12-01