Incidental Mutation 'R4382:Calr3'
ID500587
Institutional Source Beutler Lab
Gene Symbol Calr3
Ensembl Gene ENSMUSG00000019732
Gene Namecalreticulin 3
SynonymsCrt2, 6330586I20Rik, calsperin, 1700031L01Rik
MMRRC Submission 041679-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R4382 (G1)
Quality Score224
Status Not validated
Chromosome8
Chromosomal Location72424176-72443870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72428164 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 120 (D120V)
Ref Sequence ENSEMBL: ENSMUSP00000105601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019876] [ENSMUST00000109974]
Predicted Effect probably damaging
Transcript: ENSMUST00000019876
AA Change: D228V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019876
Gene: ENSMUSG00000019732
AA Change: D228V

DomainStartEndE-ValueType
Pfam:Calreticulin 23 256 5.7e-40 PFAM
Pfam:Calreticulin 255 315 6.6e-7 PFAM
low complexity region 345 359 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109974
AA Change: D120V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105601
Gene: ENSMUSG00000019732
AA Change: D120V

DomainStartEndE-ValueType
Pfam:Calreticulin 23 207 7.9e-32 PFAM
low complexity region 237 251 N/A INTRINSIC
low complexity region 257 268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120752
Meta Mutation Damage Score 0.392 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the calreticulin family, members of which are calcium-binding chaperones localized mainly in the endoplasmic reticulum. This protein is also localized to the endoplasmic reticulum lumen, however, its capacity for calcium-binding may be absent or much lower than other family members. This gene is specifically expressed in the testis, and may be required for sperm fertility. Mutation in this gene has been associated with familial hypertrophic cardiomyopathy. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with impaired zona pellucida binding and fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 T C 2: 91,208,109 S309P possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
B4galnt4 T C 7: 141,070,536 V772A probably damaging Het
BC067074 T C 13: 113,322,754 I1273T probably benign Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Ccdc92b G A 11: 74,630,016 S48N probably damaging Het
Ceacam12 C T 7: 18,066,034 probably benign Het
Clca3a1 T A 3: 144,760,722 M1L probably benign Het
Cnot1 T C 8: 95,769,779 T300A probably damaging Het
Col12a1 A T 9: 79,630,741 Y2514* probably null Het
Col6a6 G A 9: 105,783,690 R407W probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddx60 G A 8: 61,948,978 probably null Het
Dnajb12 A T 10: 59,897,499 K372N probably benign Het
Fhl5 A C 4: 25,200,118 C239G probably benign Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Glrb T A 3: 80,879,639 R72S probably damaging Het
Gm13124 T A 4: 144,555,026 T399S possibly damaging Het
Gm6811 T C 17: 21,094,603 noncoding transcript Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Hk2 A T 6: 82,735,341 L542Q probably null Het
Iglc1 A T 16: 19,061,758 C104* probably null Het
Kel T A 6: 41,698,400 T306S probably benign Het
Lpo T C 11: 87,822,201 D25G probably benign Het
Mboat7 T A 7: 3,688,546 Y109F possibly damaging Het
Myh15 T G 16: 49,142,943 N1082K probably benign Het
Nagk A G 6: 83,798,011 E90G probably benign Het
Nagpa A T 16: 5,203,955 F10I possibly damaging Het
Olfr460 T A 6: 40,572,064 L226H probably damaging Het
Otog T A 7: 46,289,698 C2051S probably damaging Het
Ptpn6 A G 6: 124,727,398 V315A possibly damaging Het
Rbp3 G C 14: 33,955,296 E400D probably benign Het
Rnf41 T C 10: 128,436,523 S140P probably benign Het
Ros1 C T 10: 52,120,959 V1206I possibly damaging Het
Scgb2b12 T A 7: 32,325,445 E112D probably benign Het
Serpinb3b T A 1: 107,155,543 M210L probably damaging Het
Sipa1l1 A G 12: 82,446,822 R1672G possibly damaging Het
Smc5 A G 19: 23,268,846 S70P probably benign Het
Spen C T 4: 141,473,139 G2703S possibly damaging Het
Stard9 C G 2: 120,634,222 A56G probably damaging Het
Wtap A G 17: 12,975,420 S87P probably damaging Het
Zzef1 T G 11: 72,875,112 S1488R probably benign Het
Other mutations in Calr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Calr3 APN 8 72431396 nonsense probably null
IGL01358:Calr3 APN 8 72427213 nonsense probably null
IGL02440:Calr3 APN 8 72431432 missense probably benign 0.30
IGL02646:Calr3 APN 8 72443460 missense possibly damaging 0.89
IGL02882:Calr3 APN 8 72434821 missense probably damaging 0.99
IGL02945:Calr3 APN 8 72438557 missense probably damaging 1.00
IGL03025:Calr3 APN 8 72434891 splice site probably benign
IGL03175:Calr3 APN 8 72443605 missense probably damaging 1.00
R0140:Calr3 UTSW 8 72434888 splice site probably benign
R1518:Calr3 UTSW 8 72427200 missense probably damaging 0.97
R1675:Calr3 UTSW 8 72431458 missense probably damaging 1.00
R2006:Calr3 UTSW 8 72434851 missense probably damaging 1.00
R2111:Calr3 UTSW 8 72427268 missense probably damaging 0.99
R2202:Calr3 UTSW 8 72434839 missense probably damaging 1.00
R2296:Calr3 UTSW 8 72424625 unclassified probably benign
R2432:Calr3 UTSW 8 72438426 unclassified probably benign
R3946:Calr3 UTSW 8 72443620 missense probably damaging 1.00
R4383:Calr3 UTSW 8 72428164 missense probably damaging 1.00
R4384:Calr3 UTSW 8 72428164 missense probably damaging 1.00
R4385:Calr3 UTSW 8 72428164 missense probably damaging 1.00
R4943:Calr3 UTSW 8 72431377 missense probably benign 0.18
R5132:Calr3 UTSW 8 72431368 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTTTCTAAGAGCACAAATGGGGC -3'
(R):5'- ATGTGTGCTCCCTAGGTTTC -3'

Sequencing Primer
(F):5'- GCAGGAGCAAGGGCCAC -3'
(R):5'- GCAATGAGGACCCAAGTTTGATTTC -3'
Posted On2017-12-01