Incidental Mutation 'R4382:Lpo'
ID500588
Institutional Source Beutler Lab
Gene Symbol Lpo
Ensembl Gene ENSMUSG00000009356
Gene Namelactoperoxidase
Synonyms
MMRRC Submission 041679-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R4382 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location87806428-87828289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87822201 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 25 (D25G)
Ref Sequence ENSEMBL: ENSMUSP00000099466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103177] [ENSMUST00000136446]
Predicted Effect probably benign
Transcript: ENSMUST00000103177
AA Change: D25G

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099466
Gene: ENSMUSG00000009356
AA Change: D25G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:An_peroxidase 136 682 1.8e-180 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136446
AA Change: D25G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117763
Gene: ENSMUSG00000009356
AA Change: D25G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PDB:4OEK|A 116 145 4e-7 PDB
SCOP:g1cxp.1 130 145 1e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157004
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peroxidase family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. Following its secretion from salivary, mammary, and other mucosal glands, this enzyme catalyzes the generation of the antimicrobial substance hypothiocyanous acid. This gene is present in a gene cluster on chromosome 17. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 T C 2: 91,208,109 S309P possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
B4galnt4 T C 7: 141,070,536 V772A probably damaging Het
BC067074 T C 13: 113,322,754 I1273T probably benign Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Ccdc92b G A 11: 74,630,016 S48N probably damaging Het
Ceacam12 C T 7: 18,066,034 probably benign Het
Clca3a1 T A 3: 144,760,722 M1L probably benign Het
Cnot1 T C 8: 95,769,779 T300A probably damaging Het
Col12a1 A T 9: 79,630,741 Y2514* probably null Het
Col6a6 G A 9: 105,783,690 R407W probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddx60 G A 8: 61,948,978 probably null Het
Dnajb12 A T 10: 59,897,499 K372N probably benign Het
Fhl5 A C 4: 25,200,118 C239G probably benign Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Glrb T A 3: 80,879,639 R72S probably damaging Het
Gm13124 T A 4: 144,555,026 T399S possibly damaging Het
Gm6811 T C 17: 21,094,603 noncoding transcript Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Hk2 A T 6: 82,735,341 L542Q probably null Het
Iglc1 A T 16: 19,061,758 C104* probably null Het
Kel T A 6: 41,698,400 T306S probably benign Het
Mboat7 T A 7: 3,688,546 Y109F possibly damaging Het
Myh15 T G 16: 49,142,943 N1082K probably benign Het
Nagk A G 6: 83,798,011 E90G probably benign Het
Nagpa A T 16: 5,203,955 F10I possibly damaging Het
Olfr460 T A 6: 40,572,064 L226H probably damaging Het
Otog T A 7: 46,289,698 C2051S probably damaging Het
Ptpn6 A G 6: 124,727,398 V315A possibly damaging Het
Rbp3 G C 14: 33,955,296 E400D probably benign Het
Rnf41 T C 10: 128,436,523 S140P probably benign Het
Ros1 C T 10: 52,120,959 V1206I possibly damaging Het
Scgb2b12 T A 7: 32,325,445 E112D probably benign Het
Serpinb3b T A 1: 107,155,543 M210L probably damaging Het
Sipa1l1 A G 12: 82,446,822 R1672G possibly damaging Het
Smc5 A G 19: 23,268,846 S70P probably benign Het
Spen C T 4: 141,473,139 G2703S possibly damaging Het
Stard9 C G 2: 120,634,222 A56G probably damaging Het
Wtap A G 17: 12,975,420 S87P probably damaging Het
Zzef1 T G 11: 72,875,112 S1488R probably benign Het
Other mutations in Lpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Lpo APN 11 87821138 missense probably benign 0.43
IGL01833:Lpo APN 11 87807333 missense possibly damaging 0.81
IGL02413:Lpo APN 11 87806906 missense possibly damaging 0.87
IGL02706:Lpo APN 11 87817773 missense probably benign 0.02
IGL02865:Lpo APN 11 87806977 missense possibly damaging 0.80
IGL02939:Lpo APN 11 87815178 missense possibly damaging 0.85
R1072:Lpo UTSW 11 87818434 missense probably damaging 1.00
R1169:Lpo UTSW 11 87817317 missense possibly damaging 0.58
R1667:Lpo UTSW 11 87807241 unclassified probably benign
R1719:Lpo UTSW 11 87809192 unclassified probably null
R2133:Lpo UTSW 11 87821130 missense probably benign 0.17
R2871:Lpo UTSW 11 87816524 missense possibly damaging 0.51
R2871:Lpo UTSW 11 87816524 missense possibly damaging 0.51
R4657:Lpo UTSW 11 87814347 missense probably damaging 1.00
R4936:Lpo UTSW 11 87810340 missense probably benign 0.02
R4969:Lpo UTSW 11 87806925 missense probably benign 0.09
R5368:Lpo UTSW 11 87821069 missense possibly damaging 0.61
R5536:Lpo UTSW 11 87816563 missense probably damaging 1.00
R6246:Lpo UTSW 11 87822232 missense unknown
R6556:Lpo UTSW 11 87817763 nonsense probably null
R6817:Lpo UTSW 11 87809241 missense probably benign
R7024:Lpo UTSW 11 87816443 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGAGCAGTGTCCCTTTGG -3'
(R):5'- GCTAGGGCATCTAAGTTTGCTG -3'

Sequencing Primer
(F):5'- CAAACAGGCTTTGCAGATCTG -3'
(R):5'- GGCATCTAAGTTTGCTGGAATTTCCC -3'
Posted On2017-12-01