Incidental Mutation 'R4365:Nfe2l2'
ID 500592
Institutional Source Beutler Lab
Gene Symbol Nfe2l2
Ensembl Gene ENSMUSG00000015839
Gene Name nuclear factor, erythroid derived 2, like 2
Synonyms Nrf2
MMRRC Submission 041113-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.885) question?
Stock # R4365 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 75505857-75534985 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75509772 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 16 (D16G)
Ref Sequence ENSEMBL: ENSMUSP00000099733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102672]
AlphaFold Q60795
PDB Structure Structural basis for the defects of human lung cancer somatic mutations in the repression activity of Keap1 on Nrf2 [X-RAY DIFFRACTION]
Crystal structure of the Keap1 protein in complexed with the N-terminal region of the Nrf2 transcription factor [X-RAY DIFFRACTION]
Crystal Structure of Keap1 in Complex with the N-terminal region of the Nrf2 transcription factor [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000102672
AA Change: D16G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099733
Gene: ENSMUSG00000015839
AA Change: D16G

DomainStartEndE-ValueType
PDB:3WN7|M 17 42 8e-10 PDB
low complexity region 43 68 N/A INTRINSIC
BRLZ 487 551 6.46e-9 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transcription factor which is a member of a small family of basic leucine zipper (bZIP) proteins. The encoded transcription factor regulates genes which contain antioxidant response elements (ARE) in their promoters; many of these genes encode proteins involved in response to injury and inflammation which includes the production of free radicals. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to oxidative stress in a variety of organs and cells including brain, liver, erythrocytes, and spleen, abnormal tooth enamel, and abnormal response to various injuries, chemical treatments, and induced inflammatory diseases. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob A T 12: 8,066,083 (GRCm39) I4318F possibly damaging Het
Btrc G A 19: 45,501,919 (GRCm39) D213N probably damaging Het
C4b T A 17: 34,953,717 (GRCm39) I964F possibly damaging Het
Cacna1f G T X: 7,476,213 (GRCm39) A123S probably damaging Het
Ccdc153 G A 9: 44,154,889 (GRCm39) A71T probably damaging Het
Celsr3 C A 9: 108,707,046 (GRCm39) D1176E possibly damaging Het
Cfap46 A C 7: 139,230,868 (GRCm39) V920G probably damaging Het
Cnot10 T A 9: 114,460,949 (GRCm39) K74* probably null Het
Dnajb12 T C 10: 59,715,588 (GRCm39) F30S probably damaging Het
Emilin3 T C 2: 160,750,406 (GRCm39) R401G probably benign Het
F5 A G 1: 164,012,519 (GRCm39) T478A probably damaging Het
Hspa4l C A 3: 40,721,241 (GRCm39) probably null Het
Il1rl2 G T 1: 40,390,951 (GRCm39) R298L probably benign Het
Lipo2 A T 19: 33,699,108 (GRCm39) S307R probably damaging Het
Lrit2 T A 14: 36,794,076 (GRCm39) L380Q probably damaging Het
Ncan A G 8: 70,567,861 (GRCm39) S84P probably damaging Het
Ncoa2 T C 1: 13,250,771 (GRCm39) I304V probably damaging Het
Nt5dc1 T C 10: 34,186,377 (GRCm39) D397G probably benign Het
Obsl1 A C 1: 75,464,693 (GRCm39) L1576R possibly damaging Het
Or5p1 A T 7: 107,916,313 (GRCm39) I71F probably benign Het
Or5v1 T C 17: 37,810,270 (GRCm39) S243P probably damaging Het
Or6c212 A G 10: 129,559,281 (GRCm39) I44T probably damaging Het
Pcdh17 A G 14: 84,685,726 (GRCm39) E731G probably damaging Het
Rag1 T A 2: 101,473,288 (GRCm39) K618M probably damaging Het
Ripor2 C T 13: 24,905,694 (GRCm39) P947S probably benign Het
Rnf150 A G 8: 83,590,744 (GRCm39) K36E probably benign Het
S100a9 T C 3: 90,600,081 (GRCm39) H105R unknown Het
Spindoc T C 19: 7,351,219 (GRCm39) D246G possibly damaging Het
St8sia4 A T 1: 95,519,517 (GRCm39) Y324N possibly damaging Het
Tlr11 T A 14: 50,598,926 (GRCm39) I304N probably damaging Het
Trpm3 A G 19: 22,955,694 (GRCm39) T1090A probably benign Het
Ube4a T C 9: 44,871,379 (GRCm39) N7D probably damaging Het
Other mutations in Nfe2l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Nfe2l2 APN 2 75,509,757 (GRCm39) missense probably damaging 1.00
IGL00931:Nfe2l2 APN 2 75,506,342 (GRCm39) missense probably damaging 1.00
IGL02207:Nfe2l2 APN 2 75,508,869 (GRCm39) missense probably damaging 1.00
IGL03356:Nfe2l2 APN 2 75,509,544 (GRCm39) missense probably benign 0.00
Scarlett UTSW 2 75,509,757 (GRCm39) missense probably damaging 1.00
R0582:Nfe2l2 UTSW 2 75,507,112 (GRCm39) missense probably damaging 1.00
R0782:Nfe2l2 UTSW 2 75,507,177 (GRCm39) missense probably benign 0.12
R1139:Nfe2l2 UTSW 2 75,507,230 (GRCm39) missense probably benign 0.00
R2237:Nfe2l2 UTSW 2 75,506,898 (GRCm39) missense probably benign 0.03
R2239:Nfe2l2 UTSW 2 75,506,898 (GRCm39) missense probably benign 0.03
R5240:Nfe2l2 UTSW 2 75,506,353 (GRCm39) missense possibly damaging 0.63
R5328:Nfe2l2 UTSW 2 75,507,200 (GRCm39) missense probably damaging 1.00
R5666:Nfe2l2 UTSW 2 75,507,462 (GRCm39) missense probably benign 0.01
R5670:Nfe2l2 UTSW 2 75,507,462 (GRCm39) missense probably benign 0.01
R6142:Nfe2l2 UTSW 2 75,509,761 (GRCm39) missense probably damaging 0.99
R6315:Nfe2l2 UTSW 2 75,507,163 (GRCm39) missense probably damaging 1.00
R6520:Nfe2l2 UTSW 2 75,506,912 (GRCm39) missense probably benign 0.00
R7621:Nfe2l2 UTSW 2 75,509,757 (GRCm39) missense probably damaging 1.00
R8110:Nfe2l2 UTSW 2 75,509,765 (GRCm39) missense probably benign 0.03
R9748:Nfe2l2 UTSW 2 75,506,667 (GRCm39) missense probably damaging 1.00
Z1176:Nfe2l2 UTSW 2 75,509,508 (GRCm39) missense probably null 0.68
Z1177:Nfe2l2 UTSW 2 75,507,123 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGCTGAATTGGGAGGAATTCTC -3'
(R):5'- CGAATGGGTAGCTAGATCTTGTTGC -3'

Sequencing Primer
(F):5'- CCTGTTTCTTCATCCAGTTGAAAC -3'
(R):5'- AGCTAGATCTTGTTGCTTTTAGC -3'
Posted On 2017-12-01