Incidental Mutation 'R4404:Vmn2r76'
ID500609
Institutional Source Beutler Lab
Gene Symbol Vmn2r76
Ensembl Gene ENSMUSG00000091239
Gene Namevomeronasal 2, receptor 76
Synonyms
MMRRC Submission 041133-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R4404 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location86225206-86246201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86228303 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 511 (T511A)
Ref Sequence ENSEMBL: ENSMUSP00000127309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165771]
Predicted Effect probably benign
Transcript: ENSMUST00000165771
AA Change: T511A

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127309
Gene: ENSMUSG00000091239
AA Change: T511A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 470 1.2e-29 PFAM
low complexity region 476 489 N/A INTRINSIC
Pfam:NCD3G 513 565 3.7e-22 PFAM
Pfam:7tm_3 598 833 1.4e-52 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
C87414 T A 5: 93,637,713 H236L possibly damaging Het
Ccdc188 A G 16: 18,218,420 Q153R probably damaging Het
Dopey1 T A 9: 86,522,813 L1721* probably null Het
Fer A T 17: 63,941,289 probably null Het
Fuk T A 8: 110,890,301 T406S probably benign Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Gria4 A T 9: 4,464,489 probably null Het
Gtf3c4 T C 2: 28,826,749 D813G probably damaging Het
Hars2 G T 18: 36,785,936 C83F probably damaging Het
Htr6 A G 4: 139,062,202 S251P probably benign Het
Igsf10 T C 3: 59,329,551 T1070A probably benign Het
Il22ra1 A T 4: 135,737,431 E149D possibly damaging Het
Lama3 G A 18: 12,582,531 M1681I probably benign Het
Loxhd1 G A 18: 77,431,132 G1878D probably damaging Het
Mcc G A 18: 44,759,298 T83M probably benign Het
Nol11 A T 11: 107,173,725 C468S probably damaging Het
Nomo1 A G 7: 46,056,668 N482S probably benign Het
Npy5r C T 8: 66,681,992 V50I probably benign Het
Olfr935 T C 9: 38,994,569 I289V possibly damaging Het
Pam T C 1: 97,854,721 probably benign Het
Pank4 C T 4: 154,980,156 T724I probably benign Het
Pifo G A 3: 106,001,368 P7L probably benign Het
Sertm1 C T 3: 54,899,325 C93Y probably damaging Het
Slc22a2 A G 17: 12,614,764 T444A probably damaging Het
Trpm7 C A 2: 126,833,715 L489F probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp25 A C 16: 77,115,453 K1020T probably damaging Het
Zdhhc15 G A X: 104,560,688 R322* probably null Het
Other mutations in Vmn2r76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Vmn2r76 APN 7 86228717 missense probably benign
IGL01374:Vmn2r76 APN 7 86225649 missense probably benign 0.02
IGL01419:Vmn2r76 APN 7 86225702 missense probably benign 0.32
IGL01627:Vmn2r76 APN 7 86225663 missense probably damaging 1.00
IGL01730:Vmn2r76 APN 7 86230198 missense probably benign 0.02
IGL01957:Vmn2r76 APN 7 86228717 missense probably benign
IGL02214:Vmn2r76 APN 7 86229930 missense probably benign 0.07
IGL02489:Vmn2r76 APN 7 86228863 missense probably benign 0.41
IGL02543:Vmn2r76 APN 7 86230148 missense probably benign 0.06
IGL02579:Vmn2r76 APN 7 86228753 nonsense probably null
IGL02598:Vmn2r76 APN 7 86228671 missense probably benign 0.05
IGL02720:Vmn2r76 APN 7 86225706 missense probably benign 0.35
IGL02745:Vmn2r76 APN 7 86230287 missense probably benign 0.06
IGL03393:Vmn2r76 APN 7 86229826 missense probably benign 0.01
R0483:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R0513:Vmn2r76 UTSW 7 86228779 missense probably benign 0.01
R0528:Vmn2r76 UTSW 7 86230298 missense possibly damaging 0.80
R0601:Vmn2r76 UTSW 7 86226115 critical splice acceptor site probably null
R0662:Vmn2r76 UTSW 7 86230370 missense probably benign 0.39
R0883:Vmn2r76 UTSW 7 86228696 missense probably benign 0.00
R1532:Vmn2r76 UTSW 7 86230246 missense probably benign 0.02
R1694:Vmn2r76 UTSW 7 86230148 missense probably benign 0.06
R1696:Vmn2r76 UTSW 7 86231256 missense possibly damaging 0.56
R2135:Vmn2r76 UTSW 7 86231011 missense probably benign 0.02
R2151:Vmn2r76 UTSW 7 86230484 missense probably benign
R2181:Vmn2r76 UTSW 7 86225535 missense probably benign 0.00
R2268:Vmn2r76 UTSW 7 86230499 missense probably benign 0.03
R2877:Vmn2r76 UTSW 7 86225993 missense probably benign 0.00
R3155:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R3746:Vmn2r76 UTSW 7 86225555 missense probably benign 0.11
R3799:Vmn2r76 UTSW 7 86226036 missense probably benign 0.00
R3825:Vmn2r76 UTSW 7 86231207 missense probably benign 0.10
R4058:Vmn2r76 UTSW 7 86230300 missense probably benign 0.00
R4237:Vmn2r76 UTSW 7 86230532 missense probably benign 0.00
R4796:Vmn2r76 UTSW 7 86230444 missense possibly damaging 0.95
R4838:Vmn2r76 UTSW 7 86225525 missense probably damaging 1.00
R5175:Vmn2r76 UTSW 7 86228707 missense probably benign 0.00
R5268:Vmn2r76 UTSW 7 86226059 missense probably damaging 1.00
R5381:Vmn2r76 UTSW 7 86225288 missense probably damaging 1.00
R5531:Vmn2r76 UTSW 7 86225449 missense probably damaging 1.00
R5566:Vmn2r76 UTSW 7 86226078 missense probably damaging 1.00
R5646:Vmn2r76 UTSW 7 86226053 missense probably damaging 0.98
R5664:Vmn2r76 UTSW 7 86245994 critical splice donor site probably null
R5818:Vmn2r76 UTSW 7 86229934 missense probably benign 0.00
R6093:Vmn2r76 UTSW 7 86228261 nonsense probably null
R6651:Vmn2r76 UTSW 7 86228851 missense possibly damaging 0.64
R6741:Vmn2r76 UTSW 7 86230352 missense probably benign
R6750:Vmn2r76 UTSW 7 86225906 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTCTGGATCATGCCAAATC -3'
(R):5'- GGCCACAGATGTTAGACAGG -3'

Sequencing Primer
(F):5'- GGATCATGCCAAATCATATTAGGGAC -3'
(R):5'- GAAACTTAATCTTTTGGTAGCCCTG -3'
Posted On2017-12-01