Incidental Mutation 'R4526:Sntb2'
ID500664
Institutional Source Beutler Lab
Gene Symbol Sntb2
Ensembl Gene ENSMUSG00000041308
Gene Namesyntrophin, basic 2
SynonymsSnt2
MMRRC Submission 041591-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.681) question?
Stock #R4526 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location106935750-107019714 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 107009963 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 490 (L490M)
Ref Sequence ENSEMBL: ENSMUSP00000148684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047425] [ENSMUST00000212524]
Predicted Effect probably benign
Transcript: ENSMUST00000047425
SMART Domains Protein: ENSMUSP00000037324
Gene: ENSMUSG00000041308

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
low complexity region 62 92 N/A INTRINSIC
low complexity region 93 99 N/A INTRINSIC
PDZ 104 178 1.48e-17 SMART
PH 144 282 3.52e0 SMART
PH 306 419 4.07e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158344
Predicted Effect probably damaging
Transcript: ENSMUST00000212524
AA Change: L490M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have no overt phenotype. They are fertile and motile with no signs of muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,096,578 R178C probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adgre4 C A 17: 55,785,016 S92* probably null Het
Arl13b T C 16: 62,812,011 D73G probably damaging Het
Cbwd1 A G 19: 24,957,964 Y59H probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Crebzf A C 7: 90,443,760 E16A possibly damaging Het
D430041D05Rik A G 2: 104,192,433 probably null Het
Dnah1 C A 14: 31,285,998 D2151Y probably benign Het
Gli3 A G 13: 15,713,631 K544E probably damaging Het
Gm17542 T C 10: 58,713,613 D31G probably null Het
Lcn9 A C 2: 25,824,508 K128T possibly damaging Het
Lman2l T C 1: 36,438,763 E164G probably damaging Het
Lpin2 T A 17: 71,237,378 probably null Het
Ly75 G A 2: 60,330,773 T900M probably benign Het
Mapk15 A T 15: 75,995,255 I74F possibly damaging Het
Myh10 C T 11: 68,815,049 T2007I probably benign Het
Nek1 T C 8: 61,106,944 S937P probably damaging Het
Oas1b T A 5: 120,822,102 probably null Het
Olfr1098 C T 2: 86,922,995 C179Y possibly damaging Het
Olfr1156 T C 2: 87,949,409 T275A probably benign Het
Olfr1269 T C 2: 90,118,672 K309E probably benign Het
Otogl G A 10: 107,886,980 P297S probably damaging Het
Plekhm1 A G 11: 103,395,304 S102P probably damaging Het
Plvap G A 8: 71,507,771 R334W probably damaging Het
Polr2b T G 5: 77,326,714 V466G probably damaging Het
Ptpn13 T C 5: 103,501,469 I246T probably benign Het
Rims2 A T 15: 39,437,717 K281N probably damaging Het
Scamp4 T C 10: 80,611,057 F108S probably damaging Het
Snrnp200 A G 2: 127,229,102 N1101S probably benign Het
Ssu2 A G 6: 112,382,422 V79A possibly damaging Het
Stard7 A G 2: 127,297,208 S347G probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r6 A G 3: 64,537,724 V860A probably benign Het
Vmn2r60 A G 7: 42,195,243 T677A probably damaging Het
Zfp318 T A 17: 46,412,358 H1762Q probably benign Het
Zmynd8 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 2: 165,807,607 probably benign Het
Other mutations in Sntb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0226:Sntb2 UTSW 8 107001583 missense probably damaging 1.00
R0345:Sntb2 UTSW 8 107001538 missense probably damaging 1.00
R0766:Sntb2 UTSW 8 107001577 missense probably damaging 1.00
R1027:Sntb2 UTSW 8 106991571 missense probably benign 0.28
R1312:Sntb2 UTSW 8 107001577 missense probably damaging 1.00
R1514:Sntb2 UTSW 8 106991532 missense probably damaging 1.00
R1942:Sntb2 UTSW 8 107011352 missense probably damaging 0.98
R2937:Sntb2 UTSW 8 106936097 missense probably benign 0.06
R3968:Sntb2 UTSW 8 106997140 nonsense probably null
R4455:Sntb2 UTSW 8 106991607 critical splice donor site probably null
R4458:Sntb2 UTSW 8 106991607 critical splice donor site probably null
R6123:Sntb2 UTSW 8 106981225 missense probably damaging 1.00
R7378:Sntb2 UTSW 8 106981312 missense probably damaging 1.00
R7458:Sntb2 UTSW 8 106936298 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GGCCAAGAGGTAAGGTTCACTG -3'
(R):5'- CGGAATGTCAAGTGTCAGGC -3'

Sequencing Primer
(F):5'- GAGGTAAGGTTCACTGTCCAC -3'
(R):5'- AGGCCCTAACTTTCTACATGGAGG -3'
Posted On2017-12-01