Incidental Mutation 'R4603:Sidt1'
ID500690
Institutional Source Beutler Lab
Gene Symbol Sidt1
Ensembl Gene ENSMUSG00000022696
Gene NameSID1 transmembrane family, member 1
SynonymsB830021E24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4603 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location44240180-44333196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44255026 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 661 (D661E)
Ref Sequence ENSEMBL: ENSMUSP00000038433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047446] [ENSMUST00000127567] [ENSMUST00000136381]
Predicted Effect probably damaging
Transcript: ENSMUST00000047446
AA Change: D661E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038433
Gene: ENSMUSG00000022696
AA Change: D661E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
Pfam:SID-1_RNA_chan 184 832 1.8e-290 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127567
SMART Domains Protein: ENSMUSP00000116201
Gene: ENSMUSG00000022696

DomainStartEndE-ValueType
Pfam:SID-1_RNA_chan 2 445 8.6e-198 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000136381
AA Change: D656E

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115372
Gene: ENSMUSG00000022696
AA Change: D656E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
Pfam:SID-1_RNA_chan 184 827 1.3e-251 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
1810024B03Rik A G 2: 127,187,099 V60A probably damaging Het
Afg3l1 A G 8: 123,501,935 T747A probably benign Het
Aldh4a1 T C 4: 139,643,429 S408P probably damaging Het
Ank2 T C 3: 127,032,016 T445A probably benign Het
Antxrl A G 14: 34,075,835 E589G possibly damaging Het
Arhgef12 C T 9: 43,010,193 G329R probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Brca2 T A 5: 150,536,165 C302S possibly damaging Het
Ccdc169 T A 3: 55,150,805 M4K probably benign Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Cdc73 T C 1: 143,677,857 probably null Het
Cse1l T C 2: 166,944,532 V604A probably benign Het
Cxcr1 G C 1: 74,192,737 T42S probably benign Het
Dhx9 TCC TC 1: 153,467,051 probably null Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Erp27 A G 6: 136,919,949 V85A probably damaging Het
Fgf8 T G 19: 45,738,153 I137L probably benign Het
Fgfrl1 T A 5: 108,703,535 V106D probably damaging Het
Gaa T C 11: 119,278,958 W613R probably damaging Het
Gabarap A G 11: 69,994,461 N66S probably benign Het
Gm13103 T A 4: 143,852,881 H345Q probably benign Het
Gm13178 A G 4: 144,703,228 V397A probably benign Het
Gp1bb A T 16: 18,621,143 L67Q probably damaging Het
Gpn1 T C 5: 31,497,352 probably null Het
Gstt1 T C 10: 75,794,135 Y48C probably damaging Het
Impad1 T C 4: 4,767,878 I299M probably damaging Het
Iqcg C T 16: 33,040,764 R194K probably null Het
Iqcg C G 16: 33,040,763 probably null Het
Kcnj3 C T 2: 55,446,979 R286* probably null Het
Klhl38 T A 15: 58,323,220 I38F possibly damaging Het
Kmo C A 1: 175,651,642 P248Q probably benign Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mprip T C 11: 59,731,573 V162A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Myocd T C 11: 65,187,745 D408G possibly damaging Het
Myt1l A G 12: 29,842,540 T59A probably benign Het
Ndufb7 A G 8: 83,566,865 E16G probably damaging Het
Ndufs7 T A 10: 80,256,667 Y203* probably null Het
Nploc4 C T 11: 120,385,787 V478I probably benign Het
Nrap A G 19: 56,335,024 probably null Het
Oit1 T A 14: 8,358,429 S57C probably damaging Het
Olfr513 A T 7: 108,755,627 Y257F probably damaging Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Pald1 T C 10: 61,348,616 T241A probably benign Het
Pdss2 T C 10: 43,372,201 S234P probably damaging Het
Pias2 T A 18: 77,130,107 V335E probably damaging Het
Ppip5k2 C A 1: 97,755,136 K187N probably damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Ppp4r1 T G 17: 65,813,464 C181G probably damaging Het
Prkdc G A 16: 15,810,824 E3478K probably damaging Het
Prpf4b T C 13: 34,888,164 probably benign Het
Psme3 T A 11: 101,317,609 probably null Het
Ptpre C A 7: 135,667,643 Y284* probably null Het
Scnn1a A G 6: 125,322,160 I94V probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Shc2 T C 10: 79,623,856 D418G probably benign Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Sorcs1 A G 19: 50,312,964 probably null Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Tmem270 C A 5: 134,901,628 E260* probably null Het
Tmtc2 T C 10: 105,413,530 Y114C probably benign Het
Trim46 A G 3: 89,243,651 F188S probably benign Het
Trim7 T A 11: 48,837,528 M1K probably null Het
Txnip A G 3: 96,558,288 E18G probably benign Het
Usp34 A G 11: 23,464,633 N2859D probably damaging Het
Vmn2r94 T A 17: 18,257,385 I255F probably benign Het
Xkr5 T A 8: 18,933,717 N603I possibly damaging Het
Zfp512 C T 5: 31,480,226 A497V probably benign Het
Zfp518b T C 5: 38,673,627 N345S probably damaging Het
Other mutations in Sidt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00709:Sidt1 APN 16 44262011 splice site probably benign
IGL01103:Sidt1 APN 16 44243543 nonsense probably null
IGL01725:Sidt1 APN 16 44284282 missense probably benign 0.06
IGL02000:Sidt1 APN 16 44286369 missense probably damaging 0.98
IGL02266:Sidt1 APN 16 44254985 missense possibly damaging 0.90
IGL02309:Sidt1 APN 16 44254980 missense probably benign 0.00
IGL02898:Sidt1 APN 16 44282495 missense possibly damaging 0.87
R0282:Sidt1 UTSW 16 44281886 missense possibly damaging 0.79
R0525:Sidt1 UTSW 16 44259446 missense possibly damaging 0.64
R0927:Sidt1 UTSW 16 44243532 missense probably benign 0.00
R1806:Sidt1 UTSW 16 44281871 missense possibly damaging 0.46
R1911:Sidt1 UTSW 16 44281871 missense possibly damaging 0.81
R3843:Sidt1 UTSW 16 44284224 missense probably benign 0.04
R3848:Sidt1 UTSW 16 44255959 intron probably benign
R4023:Sidt1 UTSW 16 44281886 missense possibly damaging 0.79
R4026:Sidt1 UTSW 16 44281886 missense possibly damaging 0.79
R4495:Sidt1 UTSW 16 44282478 missense probably damaging 1.00
R4707:Sidt1 UTSW 16 44269858 nonsense probably null
R5322:Sidt1 UTSW 16 44281622 intron probably benign
R5921:Sidt1 UTSW 16 44273735 splice site probably benign
R5980:Sidt1 UTSW 16 44263312 nonsense probably null
R5982:Sidt1 UTSW 16 44261708 missense probably damaging 1.00
R6063:Sidt1 UTSW 16 44259466 missense probably benign 0.01
R6337:Sidt1 UTSW 16 44300935 splice site probably null
R6392:Sidt1 UTSW 16 44291294 missense possibly damaging 0.47
R6855:Sidt1 UTSW 16 44245343 missense probably null 1.00
R7092:Sidt1 UTSW 16 44299829 missense possibly damaging 0.89
R7099:Sidt1 UTSW 16 44243497 missense probably damaging 1.00
R7448:Sidt1 UTSW 16 44286400 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAGGCCATCTGGTCCTTTG -3'
(R):5'- CATATAACGCATGTGCATGGTAC -3'

Sequencing Primer
(F):5'- AGGCCATCTGGTCCTTTGGAATTC -3'
(R):5'- CCGCCAAAACAACATAATTTTCTAC -3'
Posted On2017-12-01