Incidental Mutation 'R4628:Chd9'
ID500731
Institutional Source Beutler Lab
Gene Symbol Chd9
Ensembl Gene ENSMUSG00000056608
Gene Namechromodomain helicase DNA binding protein 9
Synonyms1810014J18Rik, AD013, 9030205D12Rik, A330063D19Rik
MMRRC Submission 041893-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.551) question?
Stock #R4628 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location90828352-91054516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90983463 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 289 (M289K)
Ref Sequence ENSEMBL: ENSMUSP00000147741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048665] [ENSMUST00000109614] [ENSMUST00000209203] [ENSMUST00000209423] [ENSMUST00000210947]
Predicted Effect unknown
Transcript: ENSMUST00000048665
AA Change: M762K
SMART Domains Protein: ENSMUSP00000046356
Gene: ENSMUSG00000056608
AA Change: M762K

DomainStartEndE-ValueType
low complexity region 323 334 N/A INTRINSIC
low complexity region 586 605 N/A INTRINSIC
CHROMO 687 753 2.41e-10 SMART
CHROMO 770 828 4.35e-8 SMART
DEXDc 855 1056 3.8e-36 SMART
Blast:DEXDc 1149 1174 7e-6 BLAST
HELICc 1211 1295 2.86e-22 SMART
low complexity region 1462 1475 N/A INTRINSIC
Blast:DEXDc 1506 1551 3e-16 BLAST
low complexity region 2048 2067 N/A INTRINSIC
low complexity region 2127 2199 N/A INTRINSIC
BRK 2456 2505 6.77e-25 SMART
BRK 2530 2574 1.5e-17 SMART
low complexity region 2594 2608 N/A INTRINSIC
low complexity region 2609 2639 N/A INTRINSIC
low complexity region 2642 2659 N/A INTRINSIC
low complexity region 2690 2704 N/A INTRINSIC
low complexity region 2746 2771 N/A INTRINSIC
low complexity region 2802 2813 N/A INTRINSIC
low complexity region 2843 2869 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000109614
AA Change: M762K
SMART Domains Protein: ENSMUSP00000105243
Gene: ENSMUSG00000056608
AA Change: M762K

DomainStartEndE-ValueType
low complexity region 323 334 N/A INTRINSIC
low complexity region 586 605 N/A INTRINSIC
CHROMO 687 753 2.41e-10 SMART
CHROMO 770 828 4.35e-8 SMART
DEXDc 855 1056 3.8e-36 SMART
Blast:DEXDc 1149 1174 7e-6 BLAST
HELICc 1211 1295 2.86e-22 SMART
low complexity region 1462 1475 N/A INTRINSIC
Blast:DEXDc 1506 1551 3e-16 BLAST
low complexity region 2048 2067 N/A INTRINSIC
low complexity region 2127 2199 N/A INTRINSIC
BRK 2472 2521 6.77e-25 SMART
BRK 2546 2590 1.5e-17 SMART
low complexity region 2610 2624 N/A INTRINSIC
low complexity region 2625 2655 N/A INTRINSIC
low complexity region 2658 2675 N/A INTRINSIC
low complexity region 2706 2720 N/A INTRINSIC
low complexity region 2762 2787 N/A INTRINSIC
low complexity region 2818 2829 N/A INTRINSIC
low complexity region 2859 2885 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209203
AA Change: M762K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209341
Predicted Effect unknown
Transcript: ENSMUST00000209423
AA Change: M762K
Predicted Effect probably benign
Transcript: ENSMUST00000210947
AA Change: M289K

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik G C 5: 118,259,414 A154P probably damaging Het
Abca7 G T 10: 80,015,188 probably null Het
Abcb4 A G 5: 8,907,399 D176G probably benign Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
AF366264 T A 8: 13,836,625 R489W probably damaging Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd12 T C 17: 65,985,994 T815A probably benign Het
Arid3a T C 10: 79,931,158 S89P possibly damaging Het
Ass1 A T 2: 31,480,988 D63V probably damaging Het
Atxn3 T A 12: 101,923,078 probably benign Het
Bcap29 C T 12: 31,626,807 S88N probably benign Het
Bsn G T 9: 108,113,235 P1773T probably damaging Het
Ccdc141 A G 2: 77,059,680 S423P probably benign Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Chd8 T C 14: 52,206,915 R438G probably benign Het
Col14a1 T A 15: 55,449,833 Y26* probably null Het
Colec10 A G 15: 54,459,731 T117A possibly damaging Het
Colq C A 14: 31,544,022 G178V probably damaging Het
Defb3 A T 8: 19,295,140 R37S probably benign Het
Duox1 A G 2: 122,346,252 Y1418C probably damaging Het
Engase C T 11: 118,484,905 S33F probably damaging Het
Erich3 A T 3: 154,763,687 T1259S probably damaging Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fhod3 T A 18: 25,120,129 F1379I possibly damaging Het
Fndc3b T C 3: 27,556,128 I86V probably benign Het
Gm1123 A G 9: 99,014,236 V197A probably damaging Het
Gm4847 A T 1: 166,630,395 V463E probably damaging Het
Gm9772 T C 17: 22,007,207 K32R probably damaging Het
Gm9804 T C 12: 49,401,757 S161P unknown Het
Gpr162 C T 6: 124,861,442 D82N probably benign Het
Grid2ip T C 5: 143,382,875 V650A probably damaging Het
Hs1bp3 T C 12: 8,336,357 V253A probably benign Het
Hsd3b6 T G 3: 98,806,579 K135Q possibly damaging Het
Igfn1 T C 1: 135,959,730 D2532G possibly damaging Het
Iqgap2 A G 13: 95,763,329 Y74H probably benign Het
Itga2 A G 13: 114,877,693 V233A probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lcmt1 T A 7: 123,410,812 C183* probably null Het
Lcn5 A G 2: 25,658,063 E28G possibly damaging Het
Leo1 A T 9: 75,445,697 D174V probably damaging Het
Llgl1 A T 11: 60,709,985 T636S probably damaging Het
Lrrc8e T A 8: 4,233,981 C69S probably damaging Het
Maml3 A T 3: 51,796,470 probably benign Het
Maz G T 7: 127,025,347 H334N possibly damaging Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mrpl24 A C 3: 87,922,129 probably null Het
Myo18a G A 11: 77,824,136 V834M probably damaging Het
Neb T A 2: 52,308,350 R461* probably null Het
Notch4 C A 17: 34,570,185 T486N probably damaging Het
Nphp3 A G 9: 104,003,058 E93G probably damaging Het
Nup188 A G 2: 30,329,346 Y858C probably damaging Het
Olfr339 T A 2: 36,421,857 L153* probably null Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Olfr61 C T 7: 140,638,384 R228C probably benign Het
Otud4 T A 8: 79,639,968 D21E possibly damaging Het
Ovgp1 T A 3: 105,980,323 probably null Het
Pdia3 A T 2: 121,414,139 N11I possibly damaging Het
Pex5 T C 6: 124,403,120 D286G possibly damaging Het
Pias3 T C 3: 96,699,820 I133T probably damaging Het
Postn A G 3: 54,372,157 D352G probably damaging Het
Prl7c1 T C 13: 27,778,082 R81G probably benign Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rtraf T A 14: 19,817,087 N116I probably benign Het
Slc6a12 T A 6: 121,351,992 C50* probably null Het
Srcin1 T A 11: 97,548,926 H126L probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Uroc1 A T 6: 90,355,328 I556F probably damaging Het
Vmn1r124 T A 7: 21,260,377 K81* probably null Het
Vmn1r57 T A 7: 5,220,973 C166S probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r68 A G 7: 85,234,465 V144A probably benign Het
Vmn2r85 C T 10: 130,425,366 M367I probably benign Het
Vwa3a T A 7: 120,793,375 N812K probably benign Het
Wdfy4 A T 14: 33,102,558 N1301K probably damaging Het
Zfhx4 G A 3: 5,403,476 R2898H probably damaging Het
Other mutations in Chd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Chd9 APN 8 91025392 missense possibly damaging 0.79
IGL00547:Chd9 APN 8 91005798 missense probably damaging 1.00
IGL00589:Chd9 APN 8 91015846 missense probably damaging 1.00
IGL00640:Chd9 APN 8 90986132 missense probably damaging 0.99
IGL00663:Chd9 APN 8 90983490 missense probably damaging 1.00
IGL00852:Chd9 APN 8 90973207 missense probably benign 0.29
IGL00908:Chd9 APN 8 90996880 missense probably damaging 1.00
IGL00911:Chd9 APN 8 91051692 missense probably damaging 1.00
IGL01068:Chd9 APN 8 91042116 missense probably benign 0.13
IGL01668:Chd9 APN 8 91026776 missense possibly damaging 0.53
IGL01873:Chd9 APN 8 90933767 missense probably benign 0.00
IGL01969:Chd9 APN 8 91033510 missense possibly damaging 0.72
IGL02105:Chd9 APN 8 90932488 missense probably damaging 1.00
IGL02153:Chd9 APN 8 90956494 nonsense probably null
IGL02164:Chd9 APN 8 90933221 missense possibly damaging 0.94
IGL02725:Chd9 APN 8 91051684 missense possibly damaging 0.78
IGL02755:Chd9 APN 8 91033582 missense probably benign 0.33
IGL02892:Chd9 APN 8 90976915 splice site probably benign
IGL02897:Chd9 APN 8 90933868 splice site probably benign
IGL03005:Chd9 APN 8 91011447 missense probably damaging 0.98
IGL03062:Chd9 APN 8 91015267 splice site probably benign
IGL03140:Chd9 APN 8 91042228 missense possibly damaging 0.91
R0056:Chd9 UTSW 8 90933537 missense possibly damaging 0.62
R0157:Chd9 UTSW 8 91008836 splice site probably null
R0238:Chd9 UTSW 8 90932828 missense probably damaging 1.00
R0238:Chd9 UTSW 8 90932828 missense probably damaging 1.00
R0432:Chd9 UTSW 8 90994450 splice site probably benign
R0454:Chd9 UTSW 8 90973231 missense possibly damaging 0.83
R0573:Chd9 UTSW 8 90998595 missense probably damaging 1.00
R0580:Chd9 UTSW 8 90994563 missense possibly damaging 0.91
R0604:Chd9 UTSW 8 91036542 missense possibly damaging 0.82
R0662:Chd9 UTSW 8 90977676 missense probably damaging 0.99
R0825:Chd9 UTSW 8 91051197 missense probably benign 0.06
R0945:Chd9 UTSW 8 90933002 missense possibly damaging 0.60
R0964:Chd9 UTSW 8 91015204 missense probably benign 0.19
R0967:Chd9 UTSW 8 90989479 missense probably damaging 1.00
R1015:Chd9 UTSW 8 90932578 missense probably damaging 0.99
R1066:Chd9 UTSW 8 90986136 nonsense probably null
R1244:Chd9 UTSW 8 91022929 missense probably damaging 0.99
R1505:Chd9 UTSW 8 91006495 intron probably null
R1570:Chd9 UTSW 8 91036542 missense probably benign 0.03
R1591:Chd9 UTSW 8 90983538 missense probably damaging 0.97
R1624:Chd9 UTSW 8 90998535 missense probably benign 0.17
R1626:Chd9 UTSW 8 90994596 missense probably benign 0.00
R1632:Chd9 UTSW 8 90956707 nonsense probably null
R1649:Chd9 UTSW 8 90932601 missense possibly damaging 0.88
R1664:Chd9 UTSW 8 91022790 intron probably null
R1668:Chd9 UTSW 8 91041186 missense probably damaging 0.99
R1681:Chd9 UTSW 8 90973135 missense probably damaging 0.98
R1695:Chd9 UTSW 8 91001782 missense probably damaging 1.00
R1714:Chd9 UTSW 8 91034225 utr 3 prime probably benign
R1746:Chd9 UTSW 8 91010698 missense probably benign 0.01
R1843:Chd9 UTSW 8 91010794 missense probably benign 0.19
R1844:Chd9 UTSW 8 90956695 nonsense probably null
R1941:Chd9 UTSW 8 90977069 critical splice donor site probably null
R2022:Chd9 UTSW 8 91035054 missense probably benign 0.17
R2027:Chd9 UTSW 8 90907991 unclassified probably benign
R2098:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2099:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2100:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2101:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2224:Chd9 UTSW 8 91011285 missense probably benign 0.04
R2276:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2278:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2316:Chd9 UTSW 8 91051128 missense probably damaging 0.99
R2507:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2508:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2988:Chd9 UTSW 8 91030460 intron probably null
R3418:Chd9 UTSW 8 91036591 missense probably damaging 1.00
R3817:Chd9 UTSW 8 90984265 splice site probably benign
R3923:Chd9 UTSW 8 90933519 missense probably benign 0.16
R4001:Chd9 UTSW 8 90956557 missense probably damaging 1.00
R4003:Chd9 UTSW 8 90956557 missense probably damaging 1.00
R4006:Chd9 UTSW 8 90933560 missense probably benign 0.12
R4013:Chd9 UTSW 8 90973169 missense possibly damaging 0.82
R4067:Chd9 UTSW 8 91023574 missense possibly damaging 0.53
R4108:Chd9 UTSW 8 91010676 missense probably benign 0.04
R4125:Chd9 UTSW 8 91051284 missense probably damaging 0.99
R4126:Chd9 UTSW 8 91051284 missense probably damaging 0.99
R4452:Chd9 UTSW 8 90977680 missense probably damaging 0.99
R4463:Chd9 UTSW 8 90978999 missense probably benign 0.01
R4478:Chd9 UTSW 8 91034031 utr 3 prime probably benign
R4587:Chd9 UTSW 8 91036506 missense possibly damaging 0.95
R4667:Chd9 UTSW 8 91033800 missense possibly damaging 0.73
R4908:Chd9 UTSW 8 91015249 missense possibly damaging 0.50
R4912:Chd9 UTSW 8 91034230 missense possibly damaging 0.84
R4977:Chd9 UTSW 8 91033708 missense possibly damaging 0.96
R5016:Chd9 UTSW 8 91006626 nonsense probably null
R5083:Chd9 UTSW 8 90984374 missense probably damaging 1.00
R5088:Chd9 UTSW 8 90977519 missense possibly damaging 0.94
R5090:Chd9 UTSW 8 91026834 nonsense probably null
R5307:Chd9 UTSW 8 90997149 missense probably damaging 1.00
R5541:Chd9 UTSW 8 91051504 missense probably benign 0.09
R5559:Chd9 UTSW 8 91015925 critical splice donor site probably null
R5638:Chd9 UTSW 8 91011450 missense possibly damaging 0.67
R5640:Chd9 UTSW 8 91036562 missense probably damaging 1.00
R5793:Chd9 UTSW 8 91001756 missense probably damaging 1.00
R5827:Chd9 UTSW 8 90989450 missense probably damaging 1.00
R5834:Chd9 UTSW 8 90997164 missense probably damaging 1.00
R5875:Chd9 UTSW 8 91051836 missense probably damaging 0.99
R6002:Chd9 UTSW 8 90978887 missense probably damaging 1.00
R6091:Chd9 UTSW 8 91035063 missense probably damaging 1.00
R6185:Chd9 UTSW 8 91049137 missense probably damaging 1.00
R6246:Chd9 UTSW 8 90932417 missense probably damaging 1.00
R6292:Chd9 UTSW 8 90932922 missense probably benign 0.05
R6305:Chd9 UTSW 8 91030546 missense possibly damaging 0.93
R6348:Chd9 UTSW 8 91011275 missense possibly damaging 0.95
R6438:Chd9 UTSW 8 90998521 missense probably benign 0.02
R6470:Chd9 UTSW 8 90932798 missense probably damaging 1.00
R6798:Chd9 UTSW 8 91051554 missense possibly damaging 0.56
R6902:Chd9 UTSW 8 91042951 missense probably damaging 1.00
R6908:Chd9 UTSW 8 90956416 missense probably benign 0.02
R6929:Chd9 UTSW 8 91042945 missense probably damaging 1.00
R6969:Chd9 UTSW 8 90978914 missense probably benign 0.34
X0065:Chd9 UTSW 8 91036572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTTGTATTACTTACAACATGGTG -3'
(R):5'- ACAAGTGTACTAGGTTTGAGTATTTAG -3'

Sequencing Primer
(F):5'- ACAACATGGTGGTTCATAATATCC -3'
(R):5'- TGTAAGATCCCCTGAACCTGGAG -3'
Posted On2017-12-01