Incidental Mutation 'R4628:Vmn2r114'
ID500734
Institutional Source Beutler Lab
Gene Symbol Vmn2r114
Ensembl Gene ENSMUSG00000091945
Gene Namevomeronasal 2, receptor 114
SynonymsEG666002
MMRRC Submission 041893-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R4628 (G1)
Quality Score108
Status Not validated
Chromosome17
Chromosomal Location23290934-23312313 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) ATTT to ATT at 23290932 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168033]
Predicted Effect probably null
Transcript: ENSMUST00000168033
SMART Domains Protein: ENSMUSP00000127505
Gene: ENSMUSG00000091945

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 154 470 1.5e-24 PFAM
Pfam:NCD3G 511 564 1.5e-18 PFAM
Pfam:7tm_3 597 832 1.4e-55 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik G C 5: 118,259,414 A154P probably damaging Het
Abca7 G T 10: 80,015,188 probably null Het
Abcb4 A G 5: 8,907,399 D176G probably benign Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
AF366264 T A 8: 13,836,625 R489W probably damaging Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd12 T C 17: 65,985,994 T815A probably benign Het
Arid3a T C 10: 79,931,158 S89P possibly damaging Het
Ass1 A T 2: 31,480,988 D63V probably damaging Het
Atxn3 T A 12: 101,923,078 probably benign Het
Bcap29 C T 12: 31,626,807 S88N probably benign Het
Bsn G T 9: 108,113,235 P1773T probably damaging Het
Ccdc141 A G 2: 77,059,680 S423P probably benign Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Chd8 T C 14: 52,206,915 R438G probably benign Het
Chd9 T A 8: 90,983,463 M289K probably benign Het
Col14a1 T A 15: 55,449,833 Y26* probably null Het
Colec10 A G 15: 54,459,731 T117A possibly damaging Het
Colq C A 14: 31,544,022 G178V probably damaging Het
Defb3 A T 8: 19,295,140 R37S probably benign Het
Duox1 A G 2: 122,346,252 Y1418C probably damaging Het
Engase C T 11: 118,484,905 S33F probably damaging Het
Erich3 A T 3: 154,763,687 T1259S probably damaging Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fhod3 T A 18: 25,120,129 F1379I possibly damaging Het
Fndc3b T C 3: 27,556,128 I86V probably benign Het
Gm1123 A G 9: 99,014,236 V197A probably damaging Het
Gm4847 A T 1: 166,630,395 V463E probably damaging Het
Gm9772 T C 17: 22,007,207 K32R probably damaging Het
Gm9804 T C 12: 49,401,757 S161P unknown Het
Gpr162 C T 6: 124,861,442 D82N probably benign Het
Grid2ip T C 5: 143,382,875 V650A probably damaging Het
Hs1bp3 T C 12: 8,336,357 V253A probably benign Het
Hsd3b6 T G 3: 98,806,579 K135Q possibly damaging Het
Igfn1 T C 1: 135,959,730 D2532G possibly damaging Het
Iqgap2 A G 13: 95,763,329 Y74H probably benign Het
Itga2 A G 13: 114,877,693 V233A probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lcmt1 T A 7: 123,410,812 C183* probably null Het
Lcn5 A G 2: 25,658,063 E28G possibly damaging Het
Leo1 A T 9: 75,445,697 D174V probably damaging Het
Llgl1 A T 11: 60,709,985 T636S probably damaging Het
Lrrc8e T A 8: 4,233,981 C69S probably damaging Het
Maml3 A T 3: 51,796,470 probably benign Het
Maz G T 7: 127,025,347 H334N possibly damaging Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mrpl24 A C 3: 87,922,129 probably null Het
Myo18a G A 11: 77,824,136 V834M probably damaging Het
Neb T A 2: 52,308,350 R461* probably null Het
Notch4 C A 17: 34,570,185 T486N probably damaging Het
Nphp3 A G 9: 104,003,058 E93G probably damaging Het
Nup188 A G 2: 30,329,346 Y858C probably damaging Het
Olfr339 T A 2: 36,421,857 L153* probably null Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Olfr61 C T 7: 140,638,384 R228C probably benign Het
Otud4 T A 8: 79,639,968 D21E possibly damaging Het
Ovgp1 T A 3: 105,980,323 probably null Het
Pdia3 A T 2: 121,414,139 N11I possibly damaging Het
Pex5 T C 6: 124,403,120 D286G possibly damaging Het
Pias3 T C 3: 96,699,820 I133T probably damaging Het
Postn A G 3: 54,372,157 D352G probably damaging Het
Prl7c1 T C 13: 27,778,082 R81G probably benign Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rtraf T A 14: 19,817,087 N116I probably benign Het
Slc6a12 T A 6: 121,351,992 C50* probably null Het
Srcin1 T A 11: 97,548,926 H126L probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Uroc1 A T 6: 90,355,328 I556F probably damaging Het
Vmn1r124 T A 7: 21,260,377 K81* probably null Het
Vmn1r57 T A 7: 5,220,973 C166S probably damaging Het
Vmn2r68 A G 7: 85,234,465 V144A probably benign Het
Vmn2r85 C T 10: 130,425,366 M367I probably benign Het
Vwa3a T A 7: 120,793,375 N812K probably benign Het
Wdfy4 A T 14: 33,102,558 N1301K probably damaging Het
Zfhx4 G A 3: 5,403,476 R2898H probably damaging Het
Other mutations in Vmn2r114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Vmn2r114 APN 17 23291665 missense probably damaging 1.00
IGL00990:Vmn2r114 APN 17 23290965 missense probably benign
IGL00990:Vmn2r114 APN 17 23290983 missense probably benign 0.23
IGL00990:Vmn2r114 APN 17 23291238 missense probably damaging 1.00
IGL01838:Vmn2r114 APN 17 23296982 missense probably benign 0.44
IGL01990:Vmn2r114 APN 17 23310381 missense probably benign 0.22
IGL01994:Vmn2r114 APN 17 23310477 missense probably damaging 1.00
IGL02153:Vmn2r114 APN 17 23291808 missense probably benign 0.01
IGL02453:Vmn2r114 APN 17 23311134 missense probably benign 0.00
IGL02621:Vmn2r114 APN 17 23310520 missense probably damaging 0.98
IGL02938:Vmn2r114 APN 17 23291289 missense probably benign 0.10
IGL03130:Vmn2r114 APN 17 23296996 splice site probably benign
IGL03325:Vmn2r114 APN 17 23291678 missense probably damaging 1.00
R0109:Vmn2r114 UTSW 17 23310575 nonsense probably null
R0164:Vmn2r114 UTSW 17 23309826 critical splice donor site probably null
R0310:Vmn2r114 UTSW 17 23290943 missense probably benign 0.23
R0583:Vmn2r114 UTSW 17 23290932 makesense probably null
R0677:Vmn2r114 UTSW 17 23310594 missense probably damaging 1.00
R1127:Vmn2r114 UTSW 17 23290932 makesense probably null
R1147:Vmn2r114 UTSW 17 23311063 missense probably benign 0.00
R1147:Vmn2r114 UTSW 17 23311063 missense probably benign 0.00
R1157:Vmn2r114 UTSW 17 23310340 missense possibly damaging 0.60
R1323:Vmn2r114 UTSW 17 23290932 makesense probably null
R1347:Vmn2r114 UTSW 17 23290932 makesense probably null
R1435:Vmn2r114 UTSW 17 23290932 makesense probably null
R1437:Vmn2r114 UTSW 17 23291211 missense probably damaging 1.00
R1585:Vmn2r114 UTSW 17 23291701 missense probably damaging 0.98
R1641:Vmn2r114 UTSW 17 23296988 missense probably benign 0.00
R1748:Vmn2r114 UTSW 17 23308061 missense probably benign 0.17
R1954:Vmn2r114 UTSW 17 23311112 missense probably benign 0.32
R2081:Vmn2r114 UTSW 17 23291109 missense possibly damaging 0.91
R2103:Vmn2r114 UTSW 17 23290932 makesense probably null
R2113:Vmn2r114 UTSW 17 23290932 makesense probably null
R2134:Vmn2r114 UTSW 17 23291763 missense probably damaging 1.00
R2149:Vmn2r114 UTSW 17 23290932 makesense probably null
R2424:Vmn2r114 UTSW 17 23296868 missense possibly damaging 0.90
R2847:Vmn2r114 UTSW 17 23290974 missense probably benign 0.00
R2848:Vmn2r114 UTSW 17 23290974 missense probably benign 0.00
R2893:Vmn2r114 UTSW 17 23290932 makesense probably null
R3017:Vmn2r114 UTSW 17 23290932 makesense probably null
R3018:Vmn2r114 UTSW 17 23290932 makesense probably null
R3019:Vmn2r114 UTSW 17 23290932 makesense probably null
R3020:Vmn2r114 UTSW 17 23290932 makesense probably null
R3021:Vmn2r114 UTSW 17 23290932 makesense probably null
R4668:Vmn2r114 UTSW 17 23310473 missense possibly damaging 0.83
R4840:Vmn2r114 UTSW 17 23291379 missense probably damaging 0.97
R4841:Vmn2r114 UTSW 17 23310362 missense probably benign 0.04
R4842:Vmn2r114 UTSW 17 23310362 missense probably benign 0.04
R4856:Vmn2r114 UTSW 17 23308034 missense probably benign 0.11
R4886:Vmn2r114 UTSW 17 23308034 missense probably benign 0.11
R4992:Vmn2r114 UTSW 17 23291791 missense probably benign 0.03
R5182:Vmn2r114 UTSW 17 23291658 missense probably damaging 0.96
R5223:Vmn2r114 UTSW 17 23290932 makesense probably null
R5405:Vmn2r114 UTSW 17 23290932 makesense probably null
R5449:Vmn2r114 UTSW 17 23290932 makesense probably null
R5615:Vmn2r114 UTSW 17 23290932 makesense probably null
R5834:Vmn2r114 UTSW 17 23310625 missense possibly damaging 0.90
R6150:Vmn2r114 UTSW 17 23291295 missense probably benign 0.03
R6277:Vmn2r114 UTSW 17 23290980 missense possibly damaging 0.93
R6403:Vmn2r114 UTSW 17 23309965 missense probably damaging 0.99
R6589:Vmn2r114 UTSW 17 23291668 missense probably damaging 1.00
R6613:Vmn2r114 UTSW 17 23310246 missense possibly damaging 0.82
R6747:Vmn2r114 UTSW 17 23309876 missense probably benign 0.00
R6837:Vmn2r114 UTSW 17 23310202 missense probably benign 0.10
R6911:Vmn2r114 UTSW 17 23291130 missense probably damaging 0.98
R6950:Vmn2r114 UTSW 17 23310163 missense probably benign 0.03
X0065:Vmn2r114 UTSW 17 23310957 missense probably benign 0.34
Z1088:Vmn2r114 UTSW 17 23290932 makesense probably null
Predicted Primers PCR Primer
(F):5'- GACTCCCAGTGTAAAGATTTTGTC -3'
(R):5'- ATAGCACCAAAGGCAGGGTC -3'

Sequencing Primer
(F):5'- CAGGCCATGATTATATCTGCAGAGAC -3'
(R):5'- CCAAAGGCAGGGTCATGGTG -3'
Posted On2017-12-01