Incidental Mutation 'R4629:Cacna2d2'
ID500736
Institutional Source Beutler Lab
Gene Symbol Cacna2d2
Ensembl Gene ENSMUSG00000010066
Gene Namecalcium channel, voltage-dependent, alpha 2/delta subunit 2
Synonymsa2d2
MMRRC Submission 041894-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.829) question?
Stock #R4629 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location107399612-107529343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107527322 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 1104 (E1104V)
Ref Sequence ENSEMBL: ENSMUSP00000125943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010210] [ENSMUST00000085092] [ENSMUST00000164988] [ENSMUST00000166799] [ENSMUST00000168532] [ENSMUST00000170737]
Predicted Effect probably damaging
Transcript: ENSMUST00000010210
AA Change: E1102V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010210
Gene: ENSMUSG00000010066
AA Change: E1102V

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 9.9e-32 PFAM
Pfam:VGCC_alpha2 583 673 1.8e-33 PFAM
low complexity region 968 977 N/A INTRINSIC
low complexity region 1114 1137 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085092
AA Change: E1108V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082173
Gene: ENSMUSG00000010066
AA Change: E1108V

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 676 5.8e-35 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164988
AA Change: E1111V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130451
Gene: ENSMUSG00000010066
AA Change: E1111V

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 6.7e-49 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 2.4e-31 PFAM
Pfam:VGCC_alpha2 583 675 2.5e-34 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166799
AA Change: E1111V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126029
Gene: ENSMUSG00000010066
AA Change: E1111V

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 8.5e-44 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 576 1.3e-32 PFAM
Pfam:VGCC_alpha2 583 675 1.4e-47 PFAM
low complexity region 975 984 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168532
AA Change: E1110V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132512
Gene: ENSMUSG00000010066
AA Change: E1110V

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2.1e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 676 5.8e-35 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1122 1145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168959
Predicted Effect probably damaging
Transcript: ENSMUST00000170737
AA Change: E1104V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125943
Gene: ENSMUSG00000010066
AA Change: E1104V

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 673 1.9e-33 PFAM
low complexity region 968 977 N/A INTRINSIC
low complexity region 1116 1139 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194842
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium channels mediate the entry of calcium ions into the cell upon membrane polarization. This gene encodes the alpha-2/delta subunit of the voltage-dependent calcium channel complex. The complex consists of the main channel-forming subunit alpha-1, and auxiliary subunits alpha-2/delta, beta, and gamma. The auxiliary subunits function in the assembly and membrane localization of the complex, and modulate calcium currents and channel activation/inactivation kinetics. The subunit encoded by this gene undergoes post-translational cleavage to yield the extracellular alpha2 peptide and a membrane-anchored delta polypeptide. This subunit is a receptor for the antiepileptic drug, gabapentin. Mutations in this gene are associated with early infantile epileptic encephalopathy. Single nucleotide polymorphisms in this gene are correlated with increased sensitivity to opioid drugs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for different mutant alleles show variable movement abnormalities including waddling, reeling or very slow gait, ataxia, and mild spike-wave seizures. While gross CNS abnormalities and demyelination are present in some mutant lines, they are not observed in others. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik T C 9: 114,279,351 noncoding transcript Het
Abca6 T C 11: 110,230,549 probably null Het
Adam22 A G 5: 8,232,663 S111P possibly damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alg10b C T 15: 90,227,745 A264V probably benign Het
Angpt1 T A 15: 42,438,400 Y404F probably benign Het
Apol7c A G 15: 77,526,395 F117S probably damaging Het
Asic5 T A 3: 82,006,504 Y162N probably damaging Het
Cad G A 5: 31,070,295 V1263I probably damaging Het
Cdc20 T C 4: 118,433,564 E413G probably damaging Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Cnot6l A G 5: 96,077,211 V541A probably benign Het
Cubn T A 2: 13,313,979 probably null Het
Cx3cr1 T C 9: 120,051,664 N224S probably damaging Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fez2 C T 17: 78,402,754 S202N probably benign Het
Fras1 A G 5: 96,776,734 N3678S probably benign Het
Glyr1 A G 16: 5,037,043 V57A possibly damaging Het
Gm5617 T A 9: 48,495,887 L107Q possibly damaging Het
Gpnmb A G 6: 49,051,060 D401G possibly damaging Het
Gtpbp6 C A 5: 110,106,908 V100L possibly damaging Het
Gucy1a1 A G 3: 82,097,624 V618A probably damaging Het
H6pd A T 4: 149,996,346 M14K probably benign Het
Hectd4 A G 5: 121,297,203 M993V probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lama1 A G 17: 67,805,360 probably null Het
Lgr6 T C 1: 135,104,932 Y70C probably damaging Het
Lipg T A 18: 74,948,036 K325* probably null Het
Lrrc43 T C 5: 123,499,520 L250P probably damaging Het
Lyz1 C T 10: 117,291,136 R65H probably benign Het
March10 T A 11: 105,389,838 L540F probably benign Het
Maz G T 7: 127,025,347 H334N possibly damaging Het
Myh1 A G 11: 67,209,293 K646R probably benign Het
Nf2 A T 11: 4,848,915 V24E probably damaging Het
Nup210l T C 3: 90,167,875 S831P probably benign Het
Nup210l C T 3: 90,190,874 R1378* probably null Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Palb2 A C 7: 122,127,966 I227S possibly damaging Het
Pate3 A T 9: 35,646,157 C68S probably damaging Het
Pcdha12 T A 18: 37,021,873 N548K probably damaging Het
Prdm10 C T 9: 31,337,316 Q345* probably null Het
Ptx4 A T 17: 25,122,763 N71Y probably damaging Het
Rab42 C T 4: 132,303,237 R34Q probably benign Het
Rergl A G 6: 139,501,852 V8A probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rpia A G 6: 70,766,594 M291T possibly damaging Het
Rplp0 G A 5: 115,561,423 probably null Het
Rrp12 A T 19: 41,883,516 I443N probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Saxo1 T C 4: 86,487,827 Y45C probably damaging Het
Sec24a A T 11: 51,721,813 probably null Het
Setdb2 A G 14: 59,409,359 V585A probably benign Het
Sik1 T C 17: 31,849,607 E347G probably benign Het
Srbd1 T C 17: 86,120,672 T378A probably damaging Het
Tacr1 A G 6: 82,403,880 T91A probably benign Het
Tas2r135 T A 6: 42,406,226 M233K probably benign Het
Tfg A T 16: 56,712,676 M40K probably damaging Het
Tmem35b C T 4: 127,129,003 P133S probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Trpv3 A T 11: 73,281,789 K253N probably damaging Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Unc13a A G 8: 71,653,453 M669T possibly damaging Het
Vmn1r61 T A 7: 5,611,250 I22F probably benign Het
Vmn2r26 A T 6: 124,061,191 Q575L possibly damaging Het
Vmn2r81 A T 10: 79,267,442 E156D probably damaging Het
Vwa3a T A 7: 120,793,375 N812K probably benign Het
Wasl T C 6: 24,637,681 R71G probably damaging Het
Wdfy4 A T 14: 33,102,558 N1301K probably damaging Het
Zfp72 A G 13: 74,372,393 C189R probably damaging Het
Zfp827 G A 8: 79,060,382 R59Q probably damaging Het
Other mutations in Cacna2d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Cacna2d2 APN 9 107514873 missense probably damaging 1.00
IGL00425:Cacna2d2 APN 9 107527351 missense probably damaging 1.00
IGL01294:Cacna2d2 APN 9 107514081 missense probably damaging 1.00
IGL01969:Cacna2d2 APN 9 107509216 missense probably benign
IGL01974:Cacna2d2 APN 9 107517422 missense probably benign 0.00
IGL02001:Cacna2d2 APN 9 107522116 missense probably benign
IGL02125:Cacna2d2 APN 9 107513904 nonsense probably null
IGL02143:Cacna2d2 APN 9 107518275 splice site probably null
IGL02150:Cacna2d2 APN 9 107527316 splice site probably benign
IGL02213:Cacna2d2 APN 9 107514048 missense probably damaging 1.00
IGL02220:Cacna2d2 APN 9 107514879 missense probably damaging 1.00
IGL02238:Cacna2d2 APN 9 107513558 missense probably damaging 0.99
IGL02466:Cacna2d2 APN 9 107465554 missense probably damaging 1.00
IGL02569:Cacna2d2 APN 9 107514046 missense probably damaging 0.99
IGL02571:Cacna2d2 APN 9 107525646 missense possibly damaging 0.93
IGL02825:Cacna2d2 APN 9 107524460 missense probably damaging 1.00
IGL03000:Cacna2d2 APN 9 107524198 splice site probably null
IGL03064:Cacna2d2 APN 9 107509275 missense probably damaging 1.00
Blow UTSW 9 107513606 missense probably null 0.90
hera UTSW 9 107513280 missense probably damaging 1.00
PIT4131001:Cacna2d2 UTSW 9 107524668 missense probably damaging 1.00
R0233:Cacna2d2 UTSW 9 107514670 missense probably damaging 0.96
R0233:Cacna2d2 UTSW 9 107514670 missense probably damaging 0.96
R0387:Cacna2d2 UTSW 9 107513881 missense probably damaging 1.00
R0410:Cacna2d2 UTSW 9 107524620 missense probably damaging 1.00
R0538:Cacna2d2 UTSW 9 107524383 splice site probably benign
R0545:Cacna2d2 UTSW 9 107525223 missense probably damaging 1.00
R0729:Cacna2d2 UTSW 9 107517257 missense probably benign 0.06
R1024:Cacna2d2 UTSW 9 107527050 critical splice donor site probably null
R1538:Cacna2d2 UTSW 9 107517416 missense probably damaging 1.00
R1750:Cacna2d2 UTSW 9 107524644 missense probably damaging 1.00
R1774:Cacna2d2 UTSW 9 107526151 missense probably benign 0.19
R1800:Cacna2d2 UTSW 9 107527433 missense possibly damaging 0.46
R1873:Cacna2d2 UTSW 9 107513872 missense probably damaging 0.98
R1935:Cacna2d2 UTSW 9 107509256 missense probably damaging 1.00
R1936:Cacna2d2 UTSW 9 107509256 missense probably damaging 1.00
R1971:Cacna2d2 UTSW 9 107512006 missense probably damaging 0.98
R2095:Cacna2d2 UTSW 9 107527165 missense probably benign 0.05
R2135:Cacna2d2 UTSW 9 107526513 missense possibly damaging 0.74
R2197:Cacna2d2 UTSW 9 107527403 missense probably damaging 0.97
R2266:Cacna2d2 UTSW 9 107513280 missense probably damaging 1.00
R2483:Cacna2d2 UTSW 9 107512022 missense probably damaging 1.00
R4021:Cacna2d2 UTSW 9 107514058 missense probably damaging 1.00
R4392:Cacna2d2 UTSW 9 107400280 missense possibly damaging 0.47
R5053:Cacna2d2 UTSW 9 107514864 missense probably damaging 1.00
R5327:Cacna2d2 UTSW 9 107513606 missense probably null 0.90
R5347:Cacna2d2 UTSW 9 107514114 missense probably benign
R5719:Cacna2d2 UTSW 9 107524652 missense probably benign 0.36
R5737:Cacna2d2 UTSW 9 107526747 missense possibly damaging 0.70
R5739:Cacna2d2 UTSW 9 107512329 missense probably benign 0.37
R6037:Cacna2d2 UTSW 9 107513539 missense probably damaging 1.00
R6037:Cacna2d2 UTSW 9 107513539 missense probably damaging 1.00
R6084:Cacna2d2 UTSW 9 107497521 critical splice donor site probably null
R6170:Cacna2d2 UTSW 9 107527334 missense probably damaging 1.00
R6254:Cacna2d2 UTSW 9 107509216 missense probably benign
R6427:Cacna2d2 UTSW 9 107515442 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AGACACACTGTATCCTGCCC -3'
(R):5'- TGGCCAAGGCTCTAGATTGG -3'

Sequencing Primer
(F):5'- CACGTCTTTGCCACCGC -3'
(R):5'- CCAAGGCTCTAGATTGGGGAATG -3'
Posted On2017-12-01