Incidental Mutation 'R4662:Usp9x'
ID500765
Institutional Source Beutler Lab
Gene Symbol Usp9x
Ensembl Gene ENSMUSG00000031010
Gene Nameubiquitin specific peptidase 9, X chromosome
SynonymsDffrx, Fafl, 5730589N07Rik
MMRRC Submission 042011-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.823) question?
Stock #R4662 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location13071498-13173328 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13123508 bp
ZygosityHomozygous
Amino Acid Change Arginine to Glycine at position 776 (R776G)
Ref Sequence ENSEMBL: ENSMUSP00000086716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089302] [ENSMUST00000169594]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089302
AA Change: R776G

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000086716
Gene: ENSMUSG00000031010
AA Change: R776G

DomainStartEndE-ValueType
SCOP:d1qbkb_ 249 610 1e-4 SMART
Blast:ANK 872 901 1e-6 BLAST
low complexity region 969 989 N/A INTRINSIC
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1147 1162 N/A INTRINSIC
low complexity region 1350 1361 N/A INTRINSIC
Pfam:UCH 1556 1953 8.3e-56 PFAM
Pfam:UCH_1 1557 1907 5e-24 PFAM
low complexity region 2333 2345 N/A INTRINSIC
low complexity region 2475 2487 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139764
Predicted Effect probably benign
Transcript: ENSMUST00000149021
SMART Domains Protein: ENSMUSP00000133948
Gene: ENSMUSG00000031010

DomainStartEndE-ValueType
low complexity region 74 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169594
SMART Domains Protein: ENSMUSP00000129373
Gene: ENSMUSG00000031010

DomainStartEndE-ValueType
SCOP:d1qbkb_ 249 610 7e-4 SMART
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the peptidase C19 family and encodes a protein that is similar to ubiquitin-specific proteases. Though this gene is located on the X chromosome, it escapes X-inactivation. Mutations in this gene have been associated with Turner syndrome. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: In a conditional model of pancreatic ductal carcinoma, hemizygous males and heterozygous females with a conditional allele exhibit accelerated tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A T 6: 91,914,958 Q67L probably benign Het
8030462N17Rik T A 18: 77,674,490 Q42L probably benign Het
Adrb1 A G 19: 56,722,774 T135A probably damaging Het
Asxl2 G T 12: 3,427,193 W13L probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Brsk1 T C 7: 4,707,299 S436P possibly damaging Het
Calb2 A G 8: 110,168,077 F21L probably benign Het
Camk2a T C 18: 60,941,339 Y39H probably damaging Het
Cavin2 T C 1: 51,301,351 S396P probably benign Het
Cfdp1 A G 8: 111,830,945 F188S probably benign Het
Chek2 T A 5: 110,867,042 V459D probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Cobl A G 11: 12,253,672 V1003A probably benign Het
Ctsll3 A G 13: 60,799,602 F257L possibly damaging Het
Dnajc13 A C 9: 104,207,758 F819V probably damaging Het
Dram1 C A 10: 88,325,384 V208L probably damaging Het
Dynlt1b A G 17: 6,431,880 T10A probably benign Het
Eml6 A T 11: 29,777,390 V1244E probably damaging Het
Ethe1 G A 7: 24,593,980 S17N probably benign Het
Foxi1 T C 11: 34,207,578 D149G probably damaging Het
Fzd9 T C 5: 135,249,621 E470G probably damaging Het
Ggnbp2 A G 11: 84,862,246 F56L probably damaging Het
Gm5346 T A 8: 43,627,079 Y36F probably benign Het
Hao1 G A 2: 134,523,027 R227* probably null Het
Hyal1 G A 9: 107,579,221 R369H probably damaging Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kcna2 T A 3: 107,105,417 I438N probably benign Het
Lrp1 A T 10: 127,552,185 C3331* probably null Het
Mcm9 T C 10: 53,548,527 I656V probably benign Het
Mroh9 C T 1: 163,055,593 C439Y probably damaging Het
N4bp2l2 T C 5: 150,650,695 D85G probably damaging Het
Nr1h2 A G 7: 44,550,431 Y355H probably damaging Het
Nr5a2 T C 1: 136,940,429 I322V probably benign Het
Nup153 A C 13: 46,687,274 L273V possibly damaging Het
Obscn A G 11: 58,999,596 L7370P unknown Het
Olfr1270 T A 2: 90,149,878 I43F probably damaging Het
Olfr178 A G 16: 58,889,924 C99R probably damaging Het
Olfr403 T C 11: 74,195,716 I71T probably damaging Het
Prkdc G A 16: 15,734,052 D2041N probably damaging Het
Ptdss1 A G 13: 66,933,611 D35G possibly damaging Het
Ptprs G T 17: 56,417,666 T1118K probably damaging Het
Pygb C T 2: 150,815,116 T329I probably benign Het
Rhoh T A 5: 65,892,814 D142E probably benign Het
Saraf C A 8: 34,168,462 A306E probably damaging Het
Scn1a T C 2: 66,350,988 I64V probably benign Het
Sec16a A G 2: 26,430,570 W1333R probably damaging Het
Shroom1 A T 11: 53,466,462 T651S possibly damaging Het
Skint3 C A 4: 112,277,666 Y345* probably null Het
Slc1a7 T A 4: 108,007,554 N263K probably damaging Het
Sptbn2 C T 19: 4,739,239 R1236C probably damaging Het
Tbx21 T C 11: 97,101,567 N226S probably benign Het
Tcrg-V1 T A 13: 19,340,333 L76I possibly damaging Het
Thada A G 17: 84,435,650 L782P probably damaging Het
Tle1 T G 4: 72,137,098 I446L possibly damaging Het
Triobp A G 15: 78,993,269 D1621G probably damaging Het
Trpm2 G C 10: 77,938,138 A481G probably benign Het
Unc80 A T 1: 66,646,436 M2240L probably benign Het
Vangl1 T C 3: 102,166,922 T290A probably benign Het
Vmn1r233 T A 17: 20,994,131 I186F probably benign Het
Vmn2r102 G A 17: 19,681,162 C517Y probably damaging Het
Vrk2 G A 11: 26,471,611 T449M possibly damaging Het
Zfp518a A G 19: 40,911,860 S78G probably benign Het
Zscan25 T C 5: 145,286,310 S131P unknown Het
Zscan29 G A 2: 121,166,615 T140I probably benign Het
Other mutations in Usp9x
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Usp9x APN X 13141746 missense probably benign
IGL00572:Usp9x APN X 13125576 missense probably benign
IGL00844:Usp9x APN X 13128446 missense probably benign 0.01
IGL01104:Usp9x APN X 13160903 missense probably damaging 1.00
IGL01139:Usp9x APN X 13104576 splice site probably benign
IGL01413:Usp9x APN X 13151340 missense probably benign 0.26
R3545:Usp9x UTSW X 13128390 missense probably benign 0.00
R3547:Usp9x UTSW X 13128390 missense probably benign 0.00
R3853:Usp9x UTSW X 13098583 missense probably benign 0.01
R4483:Usp9x UTSW X 13121448 missense possibly damaging 0.95
R4660:Usp9x UTSW X 13123508 missense possibly damaging 0.83
R4661:Usp9x UTSW X 13123508 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGTGGTATTCCAAATTAATGGGAGACG -3'
(R):5'- CACTTTAGCCTGCAATAGATCAAC -3'

Sequencing Primer
(F):5'- GAGACGAACCTGACTTAGATCCTG -3'
(R):5'- TAGCCTGCAATAGATCAACCTTATAC -3'
Posted On2017-12-01