Incidental Mutation 'R4931:Stat5b'
ID500839
Institutional Source Beutler Lab
Gene Symbol Stat5b
Ensembl Gene ENSMUSG00000020919
Gene Namesignal transducer and activator of transcription 5B
Synonyms
MMRRC Submission 042532-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4931 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100780731-100850724 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 100784254 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 710 (E710*)
Ref Sequence ENSEMBL: ENSMUSP00000102981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004143] [ENSMUST00000107358]
Predicted Effect probably null
Transcript: ENSMUST00000004143
AA Change: E710*
SMART Domains Protein: ENSMUSP00000004143
Gene: ENSMUSG00000020919
AA Change: E710*

DomainStartEndE-ValueType
STAT_int 2 126 2.3e-60 SMART
Pfam:STAT_alpha 138 330 1e-57 PFAM
Pfam:STAT_bind 332 583 1.6e-100 PFAM
SH2 587 676 3.23e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107358
AA Change: E710*
SMART Domains Protein: ENSMUSP00000102981
Gene: ENSMUSG00000020919
AA Change: E710*

DomainStartEndE-ValueType
STAT_int 2 126 2.3e-60 SMART
Pfam:STAT_alpha 141 330 7.1e-56 PFAM
Pfam:STAT_bind 332 582 3.3e-105 PFAM
SH2 587 676 3.23e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (78/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein mediates the signal transduction triggered by various cell ligands, such as IL2, IL4, CSF1, and different growth hormones. It has been shown to be involved in diverse biological processes, such as TCR signaling, apoptosis, adult mammary gland development, and sexual dimorphism of liver gene expression. This gene was found to fuse to retinoic acid receptor-alpha (RARA) gene in a small subset of acute promyelocytic leukemias (APLL). The dysregulation of the signaling pathways mediated by this protein may be the cause of the APLL. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this are reduced in size and mammary glands secrete reduced levels of some milk proteins during lactation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,938,120 D21G probably benign Het
4930402H24Rik A G 2: 130,741,873 F496L possibly damaging Het
4930562C15Rik T C 16: 4,861,046 L68P possibly damaging Het
Ache A G 5: 137,291,914 I414V probably benign Het
Acy1 G A 9: 106,433,191 H308Y probably damaging Het
AF529169 T C 9: 89,601,652 H564R probably benign Het
Aldh1b1 A C 4: 45,803,661 I400L probably benign Het
Ankrd40 T A 11: 94,334,821 L226Q probably benign Het
B3gnt9 T C 8: 105,254,244 T171A probably benign Het
Ccdc33 T C 9: 58,069,851 Y289C probably damaging Het
Cd209f A T 8: 4,103,688 I187N probably damaging Het
Cers6 T G 2: 69,105,112 S319A probably damaging Het
Chrna4 A G 2: 181,028,872 S364P probably benign Het
Chrnb3 T C 8: 27,394,230 S317P probably damaging Het
Dapk1 T C 13: 60,760,960 V1129A probably benign Het
Dhx9 G A 1: 153,472,673 P302L probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Duox2 T C 2: 122,296,755 N147S probably benign Het
Dytn T G 1: 63,633,678 E522A probably benign Het
E130114P18Rik T C 4: 97,720,287 D27G unknown Het
Egf A G 3: 129,711,468 F118S probably damaging Het
Eif2d T A 1: 131,154,391 F73L probably damaging Het
Eps8l1 A G 7: 4,471,241 E237G possibly damaging Het
Espl1 A G 15: 102,305,730 E664G probably benign Het
Fbrsl1 A T 5: 110,379,029 S373T possibly damaging Het
Fras1 T A 5: 96,636,840 F894Y probably benign Het
Gm12800 T C 4: 101,909,170 V17A possibly damaging Het
Gpatch8 T C 11: 102,481,224 E496G unknown Het
Gucy1a2 A G 9: 3,759,588 K465E probably damaging Het
Igdcc4 A G 9: 65,124,015 T459A possibly damaging Het
Itgad A T 7: 128,204,625 I64F probably damaging Het
Itgb2l T A 16: 96,437,449 N50I probably damaging Het
Kif13a A G 13: 46,809,055 I478T probably damaging Het
Krt31 G A 11: 100,050,157 T109I probably benign Het
Ltbr G T 6: 125,307,474 probably null Het
Magel2 A G 7: 62,380,624 D1092G unknown Het
Mindy3 A T 2: 12,396,213 N231K probably damaging Het
Mpnd T G 17: 56,012,362 probably benign Het
Mtus2 C T 5: 148,077,416 L340F probably benign Het
Nanog G A 6: 122,707,906 A17T possibly damaging Het
Ndufa9 G T 6: 126,836,320 A181E probably damaging Het
Olfr619 T G 7: 103,604,374 L240R probably benign Het
Olfr869 A T 9: 20,137,562 I149F probably benign Het
Pprc1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 19: 46,071,316 probably benign Het
Prkacb T C 3: 146,747,977 I211V possibly damaging Het
Ptpn14 C G 1: 189,851,277 L774V probably benign Het
Rad1 T C 15: 10,492,762 probably benign Het
Rims1 G T 1: 22,533,947 P391Q probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sf3b3 C T 8: 110,816,329 R832Q probably benign Het
Slc12a2 A G 18: 57,934,963 D975G possibly damaging Het
Slitrk6 A G 14: 110,750,379 L632P probably damaging Het
Spire2 A G 8: 123,368,784 D542G possibly damaging Het
Sppl3 A T 5: 115,082,314 Q95L probably damaging Het
Tcl1 G T 12: 105,222,613 H14N probably damaging Het
Ten1 T C 11: 116,205,729 F70L probably benign Het
Tnfrsf13b A T 11: 61,140,937 T35S possibly damaging Het
Tpcn2 G A 7: 145,267,309 P336L probably benign Het
Trf C A 9: 103,228,048 D22Y probably damaging Het
Ttyh1 A G 7: 4,133,944 probably benign Het
Vmn2r103 A T 17: 19,811,769 I602F probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp352 A G 4: 90,224,304 Y227C probably damaging Het
Zfp599 A T 9: 22,258,123 W18R probably damaging Het
Other mutations in Stat5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02208:Stat5b APN 11 100804913 missense probably damaging 1.00
IGL02675:Stat5b APN 11 100787374 missense probably benign 0.26
IGL02683:Stat5b APN 11 100804946 missense probably benign 0.11
IGL02725:Stat5b APN 11 100805014 missense possibly damaging 0.91
R0305:Stat5b UTSW 11 100802503 missense probably benign 0.00
R0315:Stat5b UTSW 11 100788460 missense probably benign 0.01
R0452:Stat5b UTSW 11 100798330 missense probably benign 0.00
R1267:Stat5b UTSW 11 100798593 missense probably benign 0.08
R1527:Stat5b UTSW 11 100808394 critical splice donor site probably null
R2059:Stat5b UTSW 11 100787332 missense probably benign 0.12
R2316:Stat5b UTSW 11 100796492 missense probably damaging 1.00
R2990:Stat5b UTSW 11 100808362 intron probably null
R4380:Stat5b UTSW 11 100787349 missense probably damaging 1.00
R4478:Stat5b UTSW 11 100787284 missense probably benign 0.31
R4584:Stat5b UTSW 11 100787238 missense probably damaging 1.00
R4806:Stat5b UTSW 11 100790797 missense probably benign
R5008:Stat5b UTSW 11 100802483 missense probably benign 0.00
R5015:Stat5b UTSW 11 100805005 missense possibly damaging 0.64
R5072:Stat5b UTSW 11 100808535 critical splice acceptor site probably null
R5601:Stat5b UTSW 11 100783175 missense probably damaging 0.99
R5638:Stat5b UTSW 11 100784254 nonsense probably null
R5901:Stat5b UTSW 11 100804907 missense possibly damaging 0.62
R6577:Stat5b UTSW 11 100797700 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAACTCAGTTATATCTCAAAGGC -3'
(R):5'- TACCTGCTGTGTCGGTCATG -3'

Sequencing Primer
(F):5'- CTTAGGGACTGGACTCAGGTGC -3'
(R):5'- CATGTTCTGAGTTGAGATTAAGAGGC -3'
Posted On2017-12-01