Incidental Mutation 'R0543:Olfr1444'
ID50085
Institutional Source Beutler Lab
Gene Symbol Olfr1444
Ensembl Gene ENSMUSG00000046272
Gene Nameolfactory receptor 1444
SynonymsMOR202-4, GA_x6K02T2RE5P-3191201-3192160
MMRRC Submission 038735-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R0543 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12857283-12863440 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 12861888 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 38 (V38F)
Ref Sequence ENSEMBL: ENSMUSP00000150212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059675] [ENSMUST00000213606]
Predicted Effect probably benign
Transcript: ENSMUST00000059675
AA Change: V38F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000062460
Gene: ENSMUSG00000046272
AA Change: V38F

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 1.6e-54 PFAM
Pfam:7tm_1 42 291 5.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213606
AA Change: V38F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.1324 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,289 N110K possibly damaging Het
4930444G20Rik T C 10: 22,066,924 S386G possibly damaging Het
4932438A13Rik G A 3: 36,996,458 S2981N probably benign Het
Alox5 T A 6: 116,454,317 probably null Het
Apol9b A G 15: 77,735,640 N212S probably damaging Het
Ash1l T A 3: 89,063,778 probably null Het
Ccdc180 A T 4: 45,900,041 K200* probably null Het
Ccser2 A T 14: 36,940,192 M345K probably benign Het
Cdcp2 A T 4: 107,097,676 probably null Het
Clca3a1 T C 3: 144,748,394 probably benign Het
Cntn3 G A 6: 102,269,090 probably benign Het
Col28a1 T A 6: 8,075,326 probably benign Het
Dock2 A G 11: 34,294,325 F1035S probably damaging Het
Dsg1a A T 18: 20,340,863 S998C probably damaging Het
Enox1 T C 14: 77,506,959 probably benign Het
Fgfr3 A G 5: 33,729,710 M1V probably null Het
Fuca2 T A 10: 13,503,126 Y5N probably damaging Het
Git2 G T 5: 114,745,531 H42Q probably damaging Het
Gm7964 G A 7: 83,756,394 noncoding transcript Het
Hars2 G A 18: 36,789,424 E337K probably damaging Het
Hells A G 19: 38,967,750 R797G probably benign Het
Hnf1a G A 5: 114,950,744 S571L probably benign Het
Hoxa5 T C 6: 52,204,340 Y4C probably damaging Het
Inpp4a G A 1: 37,369,492 probably benign Het
Ints6 T C 14: 62,696,611 I816V probably damaging Het
Itpr1 T C 6: 108,515,748 probably benign Het
Kcnt2 C A 1: 140,609,614 P1037T probably damaging Het
Lyg2 T A 1: 37,911,107 M47L possibly damaging Het
Macf1 G T 4: 123,376,378 A4648D probably damaging Het
Mcf2l T C 8: 12,996,728 probably null Het
Mcm9 C T 10: 53,541,598 R3H probably damaging Het
Met T A 6: 17,491,970 Y244N probably damaging Het
Mettl14 A T 3: 123,374,762 C210S possibly damaging Het
Mrgpra4 T C 7: 47,981,310 Y181C probably benign Het
Mtch2 T C 2: 90,849,682 V86A possibly damaging Het
Mttp A T 3: 138,111,696 I446N possibly damaging Het
Muc4 T A 16: 32,756,746 S2207T unknown Het
Muc5b A G 7: 141,851,785 T944A unknown Het
Myo15 A T 11: 60,479,051 H879L probably benign Het
Nkiras2 G A 11: 100,624,192 probably benign Het
Nostrin T G 2: 69,189,131 *507E probably null Het
Nup205 T C 6: 35,198,969 V589A probably benign Het
Olfr1141 C A 2: 87,753,650 L114F probably damaging Het
Olfr530 A G 7: 140,373,394 I72T probably benign Het
Oxct2b T A 4: 123,116,989 M234K possibly damaging Het
Park2 G A 17: 11,067,179 D20N probably damaging Het
Pcdha1 A T 18: 37,185,068 I945F probably damaging Het
Pdzd3 A C 9: 44,248,934 H324Q probably damaging Het
Pik3ca G A 3: 32,450,261 probably null Het
Pkhd1l1 A G 15: 44,523,491 probably null Het
Plscr1 A T 9: 92,258,046 probably null Het
Psd T C 19: 46,319,517 E684G possibly damaging Het
Rab11fip3 T C 17: 25,994,225 E870G probably damaging Het
Rpl22l1 C A 3: 28,807,274 Y103* probably null Het
Slc38a4 A T 15: 97,016,839 N44K possibly damaging Het
Slco6c1 T A 1: 97,127,898 I93F probably damaging Het
Ssfa2 T A 2: 79,644,506 S270T possibly damaging Het
Strip1 G A 3: 107,626,775 T181M possibly damaging Het
Stxbp5l G A 16: 37,208,096 A535V probably damaging Het
Tg A T 15: 66,729,597 Q152L probably benign Het
Thada T C 17: 84,423,163 T1036A probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tns1 T A 1: 73,952,697 T941S probably benign Het
Tppp3 T C 8: 105,468,208 D97G probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Trpm7 T C 2: 126,848,529 I210V probably damaging Het
Ubr1 A G 2: 120,881,093 L1440P probably damaging Het
Utp18 A T 11: 93,875,835 Y317N probably damaging Het
Zdhhc5 T A 2: 84,692,480 probably benign Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Olfr1444
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Olfr1444 APN 19 12861867 missense probably benign 0.00
IGL01963:Olfr1444 APN 19 12862382 missense probably benign 0.00
IGL02030:Olfr1444 APN 19 12862435 missense probably benign 0.00
IGL02178:Olfr1444 APN 19 12862543 missense possibly damaging 0.49
IGL02641:Olfr1444 APN 19 12862202 nonsense probably null
R0311:Olfr1444 UTSW 19 12861869 missense probably benign 0.01
R0815:Olfr1444 UTSW 19 12862644 missense probably benign 0.00
R2034:Olfr1444 UTSW 19 12861787 missense possibly damaging 0.82
R2078:Olfr1444 UTSW 19 12862387 missense probably benign 0.05
R2431:Olfr1444 UTSW 19 12862606 missense probably damaging 1.00
R3032:Olfr1444 UTSW 19 12861918 missense probably benign 0.00
R3932:Olfr1444 UTSW 19 12862630 missense possibly damaging 0.95
R4498:Olfr1444 UTSW 19 12862669 missense probably damaging 1.00
R4654:Olfr1444 UTSW 19 12862232 nonsense probably null
R4708:Olfr1444 UTSW 19 12861897 missense probably benign 0.00
R4823:Olfr1444 UTSW 19 12861816 missense probably benign 0.04
R4938:Olfr1444 UTSW 19 12862552 missense probably damaging 1.00
R4980:Olfr1444 UTSW 19 12862020 missense probably benign
R5580:Olfr1444 UTSW 19 12861804 missense possibly damaging 0.59
R5622:Olfr1444 UTSW 19 12862299 missense probably benign 0.08
R5671:Olfr1444 UTSW 19 12861807 missense probably benign 0.02
R6149:Olfr1444 UTSW 19 12862359 missense probably benign 0.02
R6683:Olfr1444 UTSW 19 12862650 missense probably damaging 0.98
R7389:Olfr1444 UTSW 19 12862617 missense probably benign 0.04
R7392:Olfr1444 UTSW 19 12862587 missense probably benign 0.18
Z1088:Olfr1444 UTSW 19 12862284 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGGGAGATATAGTAGACAGTGTGCTC -3'
(R):5'- CCTGACTGAAGTGCAGCCACCA -3'

Sequencing Primer
(F):5'- ATGATTTTTGCCAGATACTACCAC -3'
(R):5'- GAAGTGCAGCCACCATCTTG -3'
Posted On2013-06-12