Incidental Mutation 'R0543:Hells'
ID50086
Institutional Source Beutler Lab
Gene Symbol Hells
Ensembl Gene ENSMUSG00000025001
Gene Namehelicase, lymphoid specific
SynonymsYFK8, LSH, proliferation-associated SNF2-like, PASG, Lysh, E130115I21Rik
MMRRC Submission 038735-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0543 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location38930915-38971051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38967750 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 797 (R797G)
Ref Sequence ENSEMBL: ENSMUSP00000025965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025965]
Predicted Effect probably benign
Transcript: ENSMUST00000025965
AA Change: R797G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025965
Gene: ENSMUSG00000025001
AA Change: R797G

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Blast:DEXDc 40 144 4e-22 BLAST
DEXDc 202 394 7.04e-31 SMART
HELICc 612 695 5.6e-25 SMART
low complexity region 775 791 N/A INTRINSIC
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lymphoid-specific helicase. Other helicases function in processes involving DNA strand separation, including replication, repair, recombination, and transcription. This protein is thought to be involved with cellular proliferation and may play a role in leukemogenesis. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele show DNA hypomethylation, delayed growth, multiorgan and skeletal defects, premature graying, alopecia, low fat deposition, kyphosis, cachexia and early death. Homozygotes for another null allele show neonatal death, low birth weight, lymphoid defects and renal lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,289 N110K possibly damaging Het
4930444G20Rik T C 10: 22,066,924 S386G possibly damaging Het
4932438A13Rik G A 3: 36,996,458 S2981N probably benign Het
Alox5 T A 6: 116,454,317 probably null Het
Apol9b A G 15: 77,735,640 N212S probably damaging Het
Ash1l T A 3: 89,063,778 probably null Het
Ccdc180 A T 4: 45,900,041 K200* probably null Het
Ccser2 A T 14: 36,940,192 M345K probably benign Het
Cdcp2 A T 4: 107,097,676 probably null Het
Clca3a1 T C 3: 144,748,394 probably benign Het
Cntn3 G A 6: 102,269,090 probably benign Het
Col28a1 T A 6: 8,075,326 probably benign Het
Dock2 A G 11: 34,294,325 F1035S probably damaging Het
Dsg1a A T 18: 20,340,863 S998C probably damaging Het
Enox1 T C 14: 77,506,959 probably benign Het
Fgfr3 A G 5: 33,729,710 M1V probably null Het
Fuca2 T A 10: 13,503,126 Y5N probably damaging Het
Git2 G T 5: 114,745,531 H42Q probably damaging Het
Gm7964 G A 7: 83,756,394 noncoding transcript Het
Hars2 G A 18: 36,789,424 E337K probably damaging Het
Hnf1a G A 5: 114,950,744 S571L probably benign Het
Hoxa5 T C 6: 52,204,340 Y4C probably damaging Het
Inpp4a G A 1: 37,369,492 probably benign Het
Ints6 T C 14: 62,696,611 I816V probably damaging Het
Itpr1 T C 6: 108,515,748 probably benign Het
Kcnt2 C A 1: 140,609,614 P1037T probably damaging Het
Lyg2 T A 1: 37,911,107 M47L possibly damaging Het
Macf1 G T 4: 123,376,378 A4648D probably damaging Het
Mcf2l T C 8: 12,996,728 probably null Het
Mcm9 C T 10: 53,541,598 R3H probably damaging Het
Met T A 6: 17,491,970 Y244N probably damaging Het
Mettl14 A T 3: 123,374,762 C210S possibly damaging Het
Mrgpra4 T C 7: 47,981,310 Y181C probably benign Het
Mtch2 T C 2: 90,849,682 V86A possibly damaging Het
Mttp A T 3: 138,111,696 I446N possibly damaging Het
Muc4 T A 16: 32,756,746 S2207T unknown Het
Muc5b A G 7: 141,851,785 T944A unknown Het
Myo15 A T 11: 60,479,051 H879L probably benign Het
Nkiras2 G A 11: 100,624,192 probably benign Het
Nostrin T G 2: 69,189,131 *507E probably null Het
Nup205 T C 6: 35,198,969 V589A probably benign Het
Olfr1141 C A 2: 87,753,650 L114F probably damaging Het
Olfr1444 G T 19: 12,861,888 V38F probably benign Het
Olfr530 A G 7: 140,373,394 I72T probably benign Het
Oxct2b T A 4: 123,116,989 M234K possibly damaging Het
Park2 G A 17: 11,067,179 D20N probably damaging Het
Pcdha1 A T 18: 37,185,068 I945F probably damaging Het
Pdzd3 A C 9: 44,248,934 H324Q probably damaging Het
Pik3ca G A 3: 32,450,261 probably null Het
Pkhd1l1 A G 15: 44,523,491 probably null Het
Plscr1 A T 9: 92,258,046 probably null Het
Psd T C 19: 46,319,517 E684G possibly damaging Het
Rab11fip3 T C 17: 25,994,225 E870G probably damaging Het
Rpl22l1 C A 3: 28,807,274 Y103* probably null Het
Slc38a4 A T 15: 97,016,839 N44K possibly damaging Het
Slco6c1 T A 1: 97,127,898 I93F probably damaging Het
Ssfa2 T A 2: 79,644,506 S270T possibly damaging Het
Strip1 G A 3: 107,626,775 T181M possibly damaging Het
Stxbp5l G A 16: 37,208,096 A535V probably damaging Het
Tg A T 15: 66,729,597 Q152L probably benign Het
Thada T C 17: 84,423,163 T1036A probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tns1 T A 1: 73,952,697 T941S probably benign Het
Tppp3 T C 8: 105,468,208 D97G probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Trpm7 T C 2: 126,848,529 I210V probably damaging Het
Ubr1 A G 2: 120,881,093 L1440P probably damaging Het
Utp18 A T 11: 93,875,835 Y317N probably damaging Het
Zdhhc5 T A 2: 84,692,480 probably benign Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Hells
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02416:Hells APN 19 38964627 missense probably benign
IGL02639:Hells APN 19 38938429 missense probably damaging 0.99
cerberus UTSW 19 38954800 missense probably benign 0.00
charon UTSW 19 38954810 missense probably benign 0.15
intentions UTSW 19 38957199 missense probably damaging 1.00
purgatory UTSW 19 38940635 missense probably benign 0.08
R1432:Hells UTSW 19 38957184 splice site probably null
R1515:Hells UTSW 19 38967765 missense probably damaging 1.00
R1646:Hells UTSW 19 38967783 missense probably benign 0.19
R1779:Hells UTSW 19 38946842 missense probably benign 0.43
R1851:Hells UTSW 19 38959676 missense probably null 1.00
R1897:Hells UTSW 19 38940484 missense probably benign
R2040:Hells UTSW 19 38955030 missense probably damaging 0.98
R2571:Hells UTSW 19 38959733 missense possibly damaging 0.67
R4475:Hells UTSW 19 38945529 missense probably damaging 1.00
R4763:Hells UTSW 19 38957199 missense probably damaging 1.00
R4948:Hells UTSW 19 38935522 missense probably damaging 1.00
R5087:Hells UTSW 19 38943745 missense probably benign
R5517:Hells UTSW 19 38954800 missense probably benign 0.00
R5538:Hells UTSW 19 38953652 missense probably benign 0.00
R6107:Hells UTSW 19 38953649 missense probably benign 0.00
R6337:Hells UTSW 19 38954810 missense probably benign 0.15
R6577:Hells UTSW 19 38931465 nonsense probably null
R6618:Hells UTSW 19 38957084 missense probably benign 0.17
R6647:Hells UTSW 19 38931504 missense probably benign 0.01
R6869:Hells UTSW 19 38940635 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCGTTCAAACTCTGCATGATTGTCTC -3'
(R):5'- TTCCACAGGAAGACTGATAAACTTGGC -3'

Sequencing Primer
(F):5'- TGGATCAGCAAAATAAGGCTTC -3'
(R):5'- AAGACTGATAAACTTGGCAATGG -3'
Posted On2013-06-12