Incidental Mutation 'R5122:Papolg'
ID500888
Institutional Source Beutler Lab
Gene Symbol Papolg
Ensembl Gene ENSMUSG00000020273
Gene Namepoly(A) polymerase gamma
Synonyms
MMRRC Submission 042710-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R5122 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location23862646-23895253 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 23867501 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000020513] [ENSMUST00000020513] [ENSMUST00000102863]
Predicted Effect probably null
Transcript: ENSMUST00000020513
SMART Domains Protein: ENSMUSP00000020513
Gene: ENSMUSG00000020273

DomainStartEndE-ValueType
Pfam:PAP_central 20 363 1.4e-118 PFAM
Pfam:NTP_transf_2 53 174 2.8e-15 PFAM
Pfam:PAP_RNA-bind 365 431 2.4e-22 PFAM
Pfam:PAP_RNA-bind 421 506 1.2e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000020513
SMART Domains Protein: ENSMUSP00000020513
Gene: ENSMUSG00000020273

DomainStartEndE-ValueType
Pfam:PAP_central 20 363 1.4e-118 PFAM
Pfam:NTP_transf_2 53 174 2.8e-15 PFAM
Pfam:PAP_RNA-bind 365 431 2.4e-22 PFAM
Pfam:PAP_RNA-bind 421 506 1.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102863
SMART Domains Protein: ENSMUSP00000099927
Gene: ENSMUSG00000020273

DomainStartEndE-ValueType
Pfam:PAP_central 16 364 1.5e-111 PFAM
Pfam:NTP_transf_2 89 174 9.2e-12 PFAM
Pfam:PAP_RNA-bind 365 429 6.6e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000145013
SMART Domains Protein: ENSMUSP00000115518
Gene: ENSMUSG00000020273

DomainStartEndE-ValueType
SCOP:d1f5aa1 2 29 3e-10 SMART
PDB:4LT6|B 2 38 4e-16 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150711
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(A) polymerase family which catalyzes template-independent extension of the 3' end of a DNA/RNA strand. This enzyme shares 60% identity to the well characterized poly(A) polymerase II (PAPII) at the amino acid level. These two enzymes have similar organization of structural and functional domains. This enzyme is exclusively localized in the nucleus and exhibits both nonspecific and CPSF (cleavage and polyadenylation specificity factor)/AAUAAA-dependent polyadenylation activity. This gene is located on chromosome 2 in contrast to the PAPII gene, which is located on chromosome 14. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,034,757 probably null Het
Acan T C 7: 79,100,661 S1727P probably damaging Het
Actr8 A T 14: 29,982,715 K57N possibly damaging Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Bmp2k A G 5: 97,087,015 probably benign Het
Cd274 A G 19: 29,380,565 H219R possibly damaging Het
Cdc16 A T 8: 13,764,570 Y118F probably damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Chchd3 T C 6: 32,968,305 R89G probably benign Het
Clstn2 C T 9: 97,461,421 V658M probably damaging Het
Cpt1b A G 15: 89,424,023 S160P probably benign Het
Crym T C 7: 120,195,495 N167S probably benign Het
Dhx16 T A 17: 35,883,310 Y438N probably damaging Het
Dnah12 A G 14: 26,718,000 R536G probably benign Het
Dnajc11 A G 4: 151,976,997 D382G possibly damaging Het
Dync1h1 G A 12: 110,629,680 G1547D probably damaging Het
Eml3 T A 19: 8,937,696 probably null Het
Ep400 G A 5: 110,668,170 P2799S probably damaging Het
Ephb6 T C 6: 41,613,404 V30A probably benign Het
Fam53b T A 7: 132,779,262 probably benign Het
Fcrl1 A G 3: 87,385,774 K246R probably benign Het
Focad G A 4: 88,407,365 probably null Het
Glipr1l2 T C 10: 112,107,056 I272T possibly damaging Het
Gm597 A G 1: 28,780,060 S47P probably benign Het
Gm8104 A G 14: 43,109,093 I101V probably benign Het
Grm5 A G 7: 88,074,820 I773V probably damaging Het
Hyal1 A T 9: 107,578,069 T193S probably benign Het
Igkv10-94 C A 6: 68,704,671 G62* probably null Het
Itsn1 A G 16: 91,893,844 probably benign Het
Kank4 A G 4: 98,756,567 S983P probably damaging Het
Krtap16-1 C A 11: 99,985,697 V294F probably damaging Het
Lama3 T G 18: 12,539,766 V866G possibly damaging Het
Lrba C T 3: 86,349,154 R1268* probably null Het
Lrriq1 C T 10: 103,187,453 V984I probably damaging Het
Macf1 A C 4: 123,452,292 V4136G probably damaging Het
Mdn1 A T 4: 32,670,593 E419D probably damaging Het
Nedd4l A G 18: 65,191,447 Y473C probably damaging Het
Nod2 G T 8: 88,664,120 D330Y probably damaging Het
Nt5c2 C T 19: 46,889,921 C458Y probably damaging Het
Numa1 T C 7: 102,013,769 I681T probably damaging Het
Olfr713 C A 7: 107,036,848 S231* probably null Het
Parn A G 16: 13,654,447 probably null Het
Pgap2 T C 7: 102,231,391 F42S probably damaging Het
Phf11d A T 14: 59,353,344 M188K possibly damaging Het
Pofut2 G C 10: 77,268,565 R392P probably damaging Het
Prpf18 T C 2: 4,643,709 D102G probably damaging Het
Rreb1 T A 13: 37,930,768 I701N probably benign Het
Slc26a5 T C 5: 21,847,196 K45R probably damaging Het
Slc8a3 A G 12: 81,314,258 probably null Het
Slf1 T A 13: 77,049,987 M723L probably benign Het
Sra1 T C 18: 36,667,594 T187A probably benign Het
Stk17b A C 1: 53,776,558 N27K probably damaging Het
Tbc1d9 T A 8: 83,236,543 Y295N probably damaging Het
Tubgcp6 A G 15: 89,116,103 V353A probably damaging Het
Unc80 A T 1: 66,679,590 T2991S possibly damaging Het
Urb1 G A 16: 90,752,095 R2242* probably null Het
Vasp T C 7: 19,264,772 N20S probably benign Het
Zfp263 A G 16: 3,749,855 H390R probably damaging Het
Other mutations in Papolg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Papolg APN 11 23876377 missense possibly damaging 0.93
IGL01016:Papolg APN 11 23885570 missense possibly damaging 0.58
IGL01394:Papolg APN 11 23867235 missense probably benign
IGL01710:Papolg APN 11 23864026 missense probably damaging 0.99
IGL01786:Papolg APN 11 23874488 missense probably damaging 1.00
IGL02008:Papolg APN 11 23879898 missense probably damaging 1.00
IGL02127:Papolg APN 11 23870870 unclassified probably benign
IGL02329:Papolg APN 11 23891869 missense probably damaging 0.98
IGL02535:Papolg APN 11 23890245 missense probably benign 0.00
IGL02588:Papolg APN 11 23890252 missense probably damaging 1.00
IGL03058:Papolg APN 11 23895029 missense probably benign 0.00
IGL03301:Papolg APN 11 23874503 missense probably benign 0.05
R0124:Papolg UTSW 11 23867535 missense probably benign 0.21
R0369:Papolg UTSW 11 23872425 critical splice donor site probably null
R0454:Papolg UTSW 11 23879868 splice site probably null
R0743:Papolg UTSW 11 23870818 unclassified probably null
R0931:Papolg UTSW 11 23882257 missense probably damaging 0.96
R1856:Papolg UTSW 11 23867379 missense probably benign 0.06
R1940:Papolg UTSW 11 23867279 missense probably benign 0.00
R2239:Papolg UTSW 11 23876378 missense probably damaging 0.99
R3802:Papolg UTSW 11 23876449 missense probably damaging 1.00
R4275:Papolg UTSW 11 23868378 missense probably benign
R4989:Papolg UTSW 11 23873919 splice site probably null
R5074:Papolg UTSW 11 23867331 missense possibly damaging 0.78
R6048:Papolg UTSW 11 23891815 missense probably benign 0.04
R6365:Papolg UTSW 11 23882290 missense probably damaging 1.00
R6577:Papolg UTSW 11 23879857 critical splice donor site probably benign
R7117:Papolg UTSW 11 23895207 start gained probably benign
R7283:Papolg UTSW 11 23867394 missense not run
R7372:Papolg UTSW 11 23866439 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AGATGTGGTTGTCCCTGGAC -3'
(R):5'- TCGTGCTGTATAGATGGATGTACAG -3'

Sequencing Primer
(F):5'- CCTGGACAGGGTTGTGGG -3'
(R):5'- TCTTCTTGTGAGTAAGGTTGAAATAC -3'
Posted On2017-12-01