Incidental Mutation 'R0130:Lman2l'
ID50089
Institutional Source Beutler Lab
Gene Symbol Lman2l
Ensembl Gene ENSMUSG00000001143
Gene Namelectin, mannose-binding 2-like
SynonymsA630028F14Rik, VIP36-like
MMRRC Submission 038415-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.693) question?
Stock #R0130 (G1)
Quality Score225
Status Validated (trace)
Chromosome1
Chromosomal Location36419871-36445271 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 36424864 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 171 (S171*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001171] [ENSMUST00000115011] [ENSMUST00000123583] [ENSMUST00000125304] [ENSMUST00000140452] [ENSMUST00000179162]
Predicted Effect probably benign
Transcript: ENSMUST00000001171
SMART Domains Protein: ENSMUSP00000137028
Gene: ENSMUSG00000001143

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Lectin_leg-like 48 146 1.5e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115011
AA Change: S303*
SMART Domains Protein: ENSMUSP00000110663
Gene: ENSMUSG00000001143
AA Change: S303*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Lectin_leg-like 48 286 2e-84 PFAM
transmembrane domain 324 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123583
SMART Domains Protein: ENSMUSP00000137344
Gene: ENSMUSG00000001143

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000125304
AA Change: S292*
SMART Domains Protein: ENSMUSP00000117200
Gene: ENSMUSG00000001143
AA Change: S292*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Lectin_leg-like 48 275 3.2e-88 PFAM
transmembrane domain 313 335 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134594
Predicted Effect probably benign
Transcript: ENSMUST00000140452
SMART Domains Protein: ENSMUSP00000144430
Gene: ENSMUSG00000037432

DomainStartEndE-ValueType
Pfam:C2 1 78 1.4e-5 PFAM
Blast:C2 148 209 3e-37 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000152088
AA Change: S92*
SMART Domains Protein: ENSMUSP00000119798
Gene: ENSMUSG00000001143
AA Change: S92*

DomainStartEndE-ValueType
Pfam:Lectin_leg-like 1 76 1.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179162
SMART Domains Protein: ENSMUSP00000142130
Gene: ENSMUSG00000037432

DomainStartEndE-ValueType
C2 1 98 2.74e-4 SMART
C2 168 264 4.29e-6 SMART
FerI 250 323 1.59e-19 SMART
C2 325 422 1.06e-5 SMART
FerA 602 669 6.26e-18 SMART
FerB 691 764 1.38e-37 SMART
internal_repeat_1 781 836 1.77e-5 PROSPERO
internal_repeat_1 852 904 1.77e-5 PROSPERO
DysFC 913 951 1.61e-3 SMART
DysFC 981 1013 4.81e-2 SMART
C2 1078 1222 1.56e0 SMART
Pfam:C2 1248 1329 1e-1 PFAM
low complexity region 1376 1387 N/A INTRINSIC
low complexity region 1459 1470 N/A INTRINSIC
C2 1487 1586 2.21e-8 SMART
C2 1659 1851 5.32e-2 SMART
transmembrane domain 1964 1986 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000192969
AA Change: S171*
Meta Mutation Damage Score 0.572 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.7%
  • 10x: 93.4%
  • 20x: 80.2%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the L-type lectin group of type 1 membrane proteins, which function in the mammalian early secretory pathway. These proteins contain luminal carbohydrate recognition domains, which display homology to leguminous lectins. Unlike other proteins of the group, which cycle in the early secretory pathway and are predominantly associated with post endoplasmic reticulum membranes, the protein encoded by this gene is a non-cycling resident protein of the ER, where it functions as a cargo receptor for glycoproteins. It is proposed to regulate exchange of folded proteins for transport to the Golgi and exchange of misfolded glycoproteins for transport to the ubiquitin-proteasome pathway. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A T 17: 84,686,666 Y37F probably damaging Het
Ablim2 G A 5: 35,809,176 probably benign Het
Anxa9 A G 3: 95,302,422 S129P probably benign Het
Apol7c A G 15: 77,526,362 I128T possibly damaging Het
Arfgef2 T G 2: 166,835,719 I88S probably damaging Het
Arfip2 A G 7: 105,638,998 probably benign Het
Atp5j2 A T 5: 145,188,182 probably benign Het
Atp7b C T 8: 22,028,172 E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 probably null Het
Cd22 A G 7: 30,869,964 Y402H possibly damaging Het
Cd248 A G 19: 5,069,962 T613A probably benign Het
Cdcp2 C T 4: 107,106,707 probably benign Het
Cenpc1 A T 5: 86,046,546 D120E probably benign Het
Chd3 T A 11: 69,359,830 H691L probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cped1 T A 6: 22,121,039 Y373N probably benign Het
Cr2 A T 1: 195,166,231 V328D probably damaging Het
Ctnnd2 A T 15: 30,921,913 E895V probably damaging Het
D630045J12Rik A T 6: 38,149,771 probably benign Het
Dcdc2a A T 13: 25,187,672 probably benign Het
Dync1h1 C A 12: 110,618,674 T837K probably benign Het
Eif2ak3 C A 6: 70,881,732 probably benign Het
Epb41l5 A C 1: 119,549,902 V705G possibly damaging Het
Fat2 T A 11: 55,252,118 M4302L probably benign Het
Flnb T C 14: 7,901,951 V938A probably damaging Het
Frmd4a T C 2: 4,604,092 Y928H probably damaging Het
Fyn C T 10: 39,511,982 T78M probably benign Het
Gdap2 A G 3: 100,201,995 T443A probably damaging Het
Gde1 A T 7: 118,695,060 F63L probably benign Het
Gjc3 A G 5: 137,957,940 S28P probably benign Het
Gm10250 G A 15: 5,120,991 probably null Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Klhl23 T C 2: 69,833,966 V553A probably damaging Het
Lrp1b T C 2: 41,511,508 D378G probably damaging Het
Map3k11 T C 19: 5,690,815 L190P probably damaging Het
Mki67 T A 7: 135,696,459 Q2282L probably damaging Het
Mthfd2 T A 6: 83,309,008 I272F probably damaging Het
Myom1 A T 17: 71,045,755 D358V probably damaging Het
Nebl T A 2: 17,393,023 Q487H possibly damaging Het
Nebl T C 2: 17,390,926 probably benign Het
Nlrp2 T A 7: 5,322,418 N14Y possibly damaging Het
Olfr1090 T C 2: 86,753,887 M284V probably benign Het
Olfr304 T C 7: 86,386,306 Y118C probably damaging Het
Olfr339 T A 2: 36,422,287 D296E probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr992 T A 2: 85,399,961 S191C probably damaging Het
Paxip1 C T 5: 27,744,185 probably benign Het
Pclo A G 5: 14,679,797 probably benign Het
Pld2 T G 11: 70,554,348 N591K probably benign Het
Plekha7 A G 7: 116,170,704 M276T probably damaging Het
Prss39 T A 1: 34,502,200 probably benign Het
Prtg A G 9: 72,809,716 Y113C probably damaging Het
Rab38 T A 7: 88,450,541 I88N probably damaging Het
Rbfox2 A G 15: 77,091,857 probably benign Het
Samd5 A G 10: 9,674,939 W9R probably damaging Het
Sec14l1 A T 11: 117,156,407 K637I possibly damaging Het
Sh2b1 A T 7: 126,471,448 D360E possibly damaging Het
Sh3bp4 A G 1: 89,145,314 N628S possibly damaging Het
Sim1 A T 10: 50,907,961 I104F probably damaging Het
Smcp T A 3: 92,584,520 T7S unknown Het
Sp4 A G 12: 118,300,816 probably benign Het
Tectb G T 19: 55,181,961 K81N probably damaging Het
Thbs4 G T 13: 92,754,410 H850N probably benign Het
Tiam1 T C 16: 89,897,754 M272V probably benign Het
Trav13-3 T A 14: 53,729,776 noncoding transcript Het
Ubap2l A T 3: 90,021,373 S478T possibly damaging Het
Vmn2r85 A G 10: 130,419,185 probably benign Het
Other mutations in Lman2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Lman2l APN 1 36438834 critical splice acceptor site probably null
IGL02301:Lman2l APN 1 36443543 missense probably damaging 1.00
IGL03288:Lman2l APN 1 36443547 missense probably damaging 0.98
IGL03295:Lman2l APN 1 36438811 missense probably damaging 1.00
R0128:Lman2l UTSW 1 36424864 nonsense probably null
R0981:Lman2l UTSW 1 36445233 start codon destroyed unknown
R2010:Lman2l UTSW 1 36445181 nonsense probably null
R2039:Lman2l UTSW 1 36428454 missense probably damaging 1.00
R2343:Lman2l UTSW 1 36428109 missense possibly damaging 0.90
R4195:Lman2l UTSW 1 36424941 missense probably damaging 0.98
R4394:Lman2l UTSW 1 36439723 missense probably damaging 1.00
R4526:Lman2l UTSW 1 36438763 missense probably damaging 0.98
R5747:Lman2l UTSW 1 36424957 missense possibly damaging 0.90
R6156:Lman2l UTSW 1 36438826 missense probably damaging 1.00
R6264:Lman2l UTSW 1 36438769 missense probably damaging 1.00
R7013:Lman2l UTSW 1 36443518 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCTCTGACACCCACTTCTGAGGAAC -3'
(R):5'- AAAGTCGTCTTCCTGTCACTGCTG -3'

Sequencing Primer
(F):5'- CTTTGCCTGTAACAGGACAGATG -3'
(R):5'- TCACTGCTGTCAGTCAAGAG -3'
Posted On2013-06-12