Incidental Mutation 'R5291:4931414P19Rik'
ID500917
Institutional Source Beutler Lab
Gene Symbol 4931414P19Rik
Ensembl Gene ENSMUSG00000022179
Gene NameRIKEN cDNA 4931414P19 gene
Synonyms
MMRRC Submission 042874-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5291 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location54583663-54605993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54585937 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 328 (S328G)
Ref Sequence ENSEMBL: ENSMUSP00000022786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022786]
Predicted Effect probably damaging
Transcript: ENSMUST00000022786
AA Change: S328G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022786
Gene: ENSMUSG00000022179
AA Change: S328G

DomainStartEndE-ValueType
Pfam:DUF4616 2 538 1.5e-263 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082808
Predicted Effect probably benign
Transcript: ENSMUST00000227280
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228422
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot5 T G 12: 84,073,519 L216R probably benign Het
Ankrd6 A G 4: 32,823,446 L192P probably damaging Het
Atp6v1e1 C A 6: 120,818,333 probably null Het
Bbs9 T C 9: 22,628,997 Y358H probably damaging Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Camk2a A G 18: 60,957,164 K192R probably damaging Het
Ceacam1 T A 7: 25,471,831 R223W probably damaging Het
Cntn6 T A 6: 104,726,135 F173I probably damaging Het
Cntrl A C 2: 35,134,060 I33L probably damaging Het
Crybg2 T C 4: 134,073,427 S633P probably benign Het
Cyp2j13 T C 4: 96,068,329 H181R probably damaging Het
Dlgap1 A G 17: 70,718,210 S542G probably benign Het
Dnm2 T G 9: 21,478,907 L402R probably damaging Het
Fndc3b C A 3: 27,642,995 V23L probably benign Het
Gata4 A C 14: 63,240,599 F184V probably damaging Het
Gcnt2 A G 13: 40,918,792 R304G probably damaging Het
Gm10563 TTTC TTTCCTTC 4: 155,614,512 probably benign Het
Gm26558 G A 2: 70,661,529 probably benign Het
Grip1 G A 10: 120,086,969 V1107I probably benign Het
Herpud2 C T 9: 25,124,960 G135S probably benign Het
Lrp1 A G 10: 127,593,878 I441T probably damaging Het
Lrp1b T C 2: 40,903,003 D2553G probably damaging Het
Mkln1 T A 6: 31,490,481 N43K possibly damaging Het
Olfr1259 A T 2: 89,943,436 Y226* probably null Het
Olfr181 T C 16: 58,926,401 T57A possibly damaging Het
Paxbp1 C T 16: 91,044,352 M1I probably null Het
Phip A G 9: 82,945,883 Y97H probably damaging Het
Plec T A 15: 76,174,011 I3774F probably damaging Het
Pramef6 G T 4: 143,895,667 P373T probably damaging Het
Prrc2c C A 1: 162,705,582 probably benign Het
Prss12 T C 3: 123,505,463 L628P probably damaging Het
Ptpre G A 7: 135,678,301 V578I probably benign Het
Qsox2 A T 2: 26,217,698 L261H probably damaging Het
Rapgef2 A T 3: 79,070,059 V1327E possibly damaging Het
Rnf216 A G 5: 143,090,212 S306P probably benign Het
Rtel1 A G 2: 181,352,095 Q640R possibly damaging Het
Ryr1 T A 7: 29,115,598 D175V probably benign Het
Scarf1 T C 11: 75,524,074 S525P probably damaging Het
Senp7 T A 16: 56,186,179 Y982* probably null Het
Slc35b2 T C 17: 45,566,498 Y184H probably damaging Het
Sned1 A G 1: 93,295,724 K1375E possibly damaging Het
Spats2 G T 15: 99,178,541 A167S probably benign Het
Spen C A 4: 141,488,079 A481S unknown Het
Spred3 T A 7: 29,167,830 H47L probably damaging Het
Srsf4 T A 4: 131,886,306 probably benign Het
Tdrd3 A T 14: 87,505,798 H394L probably benign Het
Terf1 A G 1: 15,819,086 probably null Het
Txlnb A T 10: 17,799,396 D99V possibly damaging Het
Ugt1a7c A T 1: 88,095,509 N130I possibly damaging Het
Vmn2r50 T A 7: 10,047,825 D331V probably damaging Het
Vps13d A G 4: 145,062,569 I744T probably damaging Het
Ythdc1 A G 5: 86,835,688 D664G probably damaging Het
Other mutations in 4931414P19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:4931414P19Rik APN 14 54595578 missense possibly damaging 0.56
IGL01448:4931414P19Rik APN 14 54585960 missense possibly damaging 0.77
IGL01934:4931414P19Rik APN 14 54585655 missense probably damaging 1.00
IGL02194:4931414P19Rik APN 14 54591355 nonsense probably null
IGL02721:4931414P19Rik APN 14 54585745 missense probably damaging 1.00
IGL03124:4931414P19Rik APN 14 54595139 missense probably benign 0.00
R0575:4931414P19Rik UTSW 14 54591252 missense possibly damaging 0.62
R2049:4931414P19Rik UTSW 14 54584987 nonsense probably null
R3829:4931414P19Rik UTSW 14 54584509 missense probably damaging 1.00
R3876:4931414P19Rik UTSW 14 54591400 nonsense probably null
R4392:4931414P19Rik UTSW 14 54584978 critical splice donor site probably null
R4680:4931414P19Rik UTSW 14 54585076 missense probably damaging 1.00
R4805:4931414P19Rik UTSW 14 54595454 missense probably benign 0.00
R4940:4931414P19Rik UTSW 14 54591325 missense probably benign
R5091:4931414P19Rik UTSW 14 54585711 missense probably damaging 1.00
R5594:4931414P19Rik UTSW 14 54584984 missense probably damaging 1.00
R6815:4931414P19Rik UTSW 14 54591153 missense probably damaging 1.00
R7031:4931414P19Rik UTSW 14 54595601 missense probably benign 0.23
R7229:4931414P19Rik UTSW 14 54595352 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTTGAGCTTTTCCAGAAGGAAC -3'
(R):5'- AGCAGAAGTGACTCAGCCAG -3'

Sequencing Primer
(F):5'- ACGACTTAATGCTGTCACGG -3'
(R):5'- GAGAACCCACACTCATGGAG -3'
Posted On2017-12-01