Incidental Mutation 'R5343:Sfi1'
ID500952
Institutional Source Beutler Lab
Gene Symbol Sfi1
Ensembl Gene ENSMUSG00000023764
Gene NameSfi1 homolog, spindle assembly associated (yeast)
Synonyms
MMRRC Submission 042922-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R5343 (G1)
Quality Score179
Status Not validated
Chromosome11
Chromosomal Location3131850-3193463 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to ATCTTCCCAAAGCCAGTGC at 3153384 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066391] [ENSMUST00000081318] [ENSMUST00000101655] [ENSMUST00000132893] [ENSMUST00000140846] [ENSMUST00000153425]
Predicted Effect probably benign
Transcript: ENSMUST00000066391
SMART Domains Protein: ENSMUSP00000067261
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_2 34 236 4.95e-5 PROSPERO
internal_repeat_1 78 336 3.02e-14 PROSPERO
low complexity region 342 358 N/A INTRINSIC
internal_repeat_1 372 636 3.02e-14 PROSPERO
internal_repeat_2 574 804 4.95e-5 PROSPERO
low complexity region 809 821 N/A INTRINSIC
low complexity region 849 860 N/A INTRINSIC
coiled coil region 1086 1112 N/A INTRINSIC
coiled coil region 1138 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081318
SMART Domains Protein: ENSMUSP00000080066
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_3 55 275 2e-6 PROSPERO
internal_repeat_1 67 288 7.56e-9 PROSPERO
internal_repeat_2 93 401 1.18e-6 PROSPERO
internal_repeat_3 380 607 2e-6 PROSPERO
internal_repeat_1 428 651 7.56e-9 PROSPERO
internal_repeat_2 524 836 1.18e-6 PROSPERO
low complexity region 841 853 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
coiled coil region 1118 1144 N/A INTRINSIC
coiled coil region 1170 1200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101655
SMART Domains Protein: ENSMUSP00000099178
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_3 55 275 1.77e-6 PROSPERO
internal_repeat_1 67 288 6.51e-9 PROSPERO
internal_repeat_2 93 401 1.04e-6 PROSPERO
internal_repeat_3 380 607 1.77e-6 PROSPERO
internal_repeat_1 428 651 6.51e-9 PROSPERO
internal_repeat_2 524 836 1.04e-6 PROSPERO
low complexity region 841 853 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
coiled coil region 1107 1133 N/A INTRINSIC
coiled coil region 1159 1189 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120853
Predicted Effect probably benign
Transcript: ENSMUST00000126746
SMART Domains Protein: ENSMUSP00000122002
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
low complexity region 73 89 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132893
SMART Domains Protein: ENSMUSP00000118419
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
low complexity region 210 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138126
Predicted Effect probably benign
Transcript: ENSMUST00000140846
SMART Domains Protein: ENSMUSP00000119905
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_1 3 301 3.65e-15 PROSPERO
internal_repeat_2 12 320 8.53e-7 PROSPERO
internal_repeat_1 301 599 3.65e-15 PROSPERO
internal_repeat_2 443 755 8.53e-7 PROSPERO
low complexity region 760 772 N/A INTRINSIC
low complexity region 800 811 N/A INTRINSIC
coiled coil region 1026 1052 N/A INTRINSIC
coiled coil region 1078 1108 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144778
Predicted Effect probably benign
Transcript: ENSMUST00000153425
SMART Domains Protein: ENSMUSP00000121719
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_1 67 288 6.06e-9 PROSPERO
internal_repeat_3 69 314 2.4e-5 PROSPERO
internal_repeat_2 93 340 2.83e-6 PROSPERO
low complexity region 342 358 N/A INTRINSIC
internal_repeat_1 397 620 6.06e-9 PROSPERO
internal_repeat_2 493 744 2.83e-6 PROSPERO
internal_repeat_3 531 799 2.4e-5 PROSPERO
low complexity region 810 822 N/A INTRINSIC
low complexity region 850 861 N/A INTRINSIC
coiled coil region 1076 1102 N/A INTRINSIC
coiled coil region 1128 1158 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156655
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik C A 17: 46,773,036 A75E probably damaging Het
5730559C18Rik G T 1: 136,225,442 H237Q probably benign Het
Adck5 G A 15: 76,595,580 R560H probably damaging Het
Ahctf1 A T 1: 179,770,634 Y964* probably null Het
Alg8 T C 7: 97,386,919 I339T possibly damaging Het
Alox5 T C 6: 116,413,507 D503G possibly damaging Het
Camk4 A G 18: 33,078,069 T76A probably damaging Het
Cdh3 T C 8: 106,552,936 V728A probably benign Het
Chd4 T A 6: 125,120,363 N1326K probably damaging Het
Cnn1 A T 9: 22,105,410 Y48F probably benign Het
Dnah6 T A 6: 73,212,616 E16D probably benign Het
Ezh2 A G 6: 47,576,615 L56S probably damaging Het
F13b T C 1: 139,510,544 V299A possibly damaging Het
Hydin T C 8: 110,485,419 S1279P probably benign Het
Ift172 T C 5: 31,263,812 M981V probably benign Het
Lpl T A 8: 68,895,737 V206E probably damaging Het
Mre11a A G 9: 14,811,834 D368G probably damaging Het
Mreg G A 1: 72,160,958 P191L probably damaging Het
Mtif2 G T 11: 29,536,964 A134S probably damaging Het
Mxd4 T C 5: 34,177,730 S114G probably benign Het
Myo1b T C 1: 51,778,537 Q522R probably benign Het
Ncapd3 GGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTG 9: 27,088,053 probably benign Het
Ninl T C 2: 150,971,190 E182G probably benign Het
Notch3 T C 17: 32,143,283 N1456S probably benign Het
Npr1 G T 3: 90,458,208 N648K possibly damaging Het
Oas3 A G 5: 120,756,238 S1016P possibly damaging Het
Olfr1499 T C 19: 13,814,960 N210S probably damaging Het
Olfr518 C T 7: 108,880,998 V203M possibly damaging Het
Palld A G 8: 61,549,815 probably benign Het
Patj T G 4: 98,676,193 I1021S probably damaging Het
Pfpl T A 19: 12,428,688 L101Q probably damaging Het
Pilrb2 T A 5: 137,870,966 E124V possibly damaging Het
Pomk A G 8: 25,983,016 F303S probably benign Het
Rap1gap2 A T 11: 74,441,785 S65T probably damaging Het
Sema3a G A 5: 13,473,406 C114Y probably damaging Het
Spry4 A T 18: 38,589,975 V245E probably damaging Het
Srrt T C 5: 137,297,165 Y271C probably damaging Het
Tas2r136 A G 6: 132,778,080 V28A probably benign Het
Tenm2 A G 11: 36,069,503 V998A probably benign Het
Trim37 A G 11: 87,137,603 E46G probably damaging Het
Ubiad1 A G 4: 148,436,435 V244A possibly damaging Het
Other mutations in Sfi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Sfi1 APN 11 3134337 missense probably benign 0.05
IGL00990:Sfi1 APN 11 3135671 missense probably damaging 0.99
IGL00990:Sfi1 APN 11 3143689 splice site probably benign
IGL03147:Sfi1 UTSW 11 3186080 missense possibly damaging 0.94
R0081:Sfi1 UTSW 11 3146254 frame shift probably null
R0082:Sfi1 UTSW 11 3146254 frame shift probably null
R0118:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R0197:Sfi1 UTSW 11 3146254 frame shift probably null
R0241:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R0241:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R0242:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R0816:Sfi1 UTSW 11 3146254 frame shift probably null
R1147:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1148:Sfi1 UTSW 11 3146254 frame shift probably null
R1148:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1185:Sfi1 UTSW 11 3146254 frame shift probably null
R1185:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1207:Sfi1 UTSW 11 3146254 frame shift probably null
R1207:Sfi1 UTSW 11 3146255 frame shift probably null
R1207:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1403:Sfi1 UTSW 11 3146254 frame shift probably null
R1403:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1404:Sfi1 UTSW 11 3146254 frame shift probably null
R1404:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1405:Sfi1 UTSW 11 3146254 frame shift probably null
R1405:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1465:Sfi1 UTSW 11 3146254 frame shift probably null
R1469:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1470:Sfi1 UTSW 11 3146254 frame shift probably null
R1470:Sfi1 UTSW 11 3146255 frame shift probably null
R1574:Sfi1 UTSW 11 3146254 frame shift probably null
R2871:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R5228:Sfi1 UTSW 11 3153384 intron probably benign
R5276:Sfi1 UTSW 11 3153384 intron probably benign
R5298:Sfi1 UTSW 11 3153384 intron probably benign
R5376:Sfi1 UTSW 11 3153384 intron probably benign
R5384:Sfi1 UTSW 11 3153382 intron probably benign
R5385:Sfi1 UTSW 11 3153382 intron probably benign
R5386:Sfi1 UTSW 11 3153384 intron probably benign
R5411:Sfi1 UTSW 11 3153384 intron probably benign
R5431:Sfi1 UTSW 11 3153384 intron probably benign
R5795:Sfi1 UTSW 11 3153384 intron probably benign
R5808:Sfi1 UTSW 11 3153384 intron probably benign
Predicted Primers PCR Primer
(F):5'- CAACATAGTACAGGGTCTAAGGC -3'
(R):5'- ATGAGCGTGAAACCTGGCAG -3'

Sequencing Primer
(F):5'- CAAAGCCGGTGTGTAGTAAGTCTC -3'
(R):5'- CGTGAAACCTGGCAGTATTGATC -3'
Posted On2017-12-01