Mutagenetix > Incidental Mutation

Incidental Mutation 'R5349:Nr1i3'

500967

Institutional Source

Beutler Lab

Gene Symbol

Nr1i3

Ensembl Gene

ENSMUSG00000005677

Gene Name

nuclear receptor subfamily 1, group I, member 3

Synonyms

mCAR, ESTM32, CAR, CAR1, MB67, Care2

MMRRC Submission

042928-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5349 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

171041503-171046414 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 171042641 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 89 (D89G)

Ref Sequence

ENSEMBL: ENSMUSP00000106960 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005817] [ENSMUST00000005820] [ENSMUST00000075469] [ENSMUST00000111326] [ENSMUST00000111327] [ENSMUST00000111328] [ENSMUST00000133075] [ENSMUST00000155126] [ENSMUST00000143405]

AlphaFold

O35627

Predicted Effect

probably benign
Transcript: ENSMUST00000005817

SMART Domains

Protein: ENSMUSP00000005817
Gene: ENSMUSG00000005674

Domain	Start	End	E-Value	Type
Pfam:Porin_3	26	302	7.2e-76	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000005820
AA Change: D89G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000005820
Gene: ENSMUSG00000005677
AA Change: D89G

Domain	Start	End	E-Value	Type
ZnF_C4	18	89	6.98e-35	SMART
low complexity region	94	110	N/A	INTRINSIC
HOLI	173	333	5.55e-29	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075469
AA Change: D89G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000074915
Gene: ENSMUSG00000005677
AA Change: D89G

Domain	Start	End	E-Value	Type
ZnF_C4	18	89	6.98e-35	SMART
low complexity region	94	110	N/A	INTRINSIC
HOLI	173	285	8.9e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111326

SMART Domains

Protein: ENSMUSP00000106958
Gene: ENSMUSG00000005674

Domain	Start	End	E-Value	Type
Pfam:Porin_3	26	95	9e-16	PFAM
Pfam:Porin_3	85	268	1.4e-49	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111327

SMART Domains

Protein: ENSMUSP00000106959
Gene: ENSMUSG00000005674

Domain	Start	End	E-Value	Type
Pfam:Porin_3	26	302	3.4e-68	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111328
AA Change: D89G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000106960
Gene: ENSMUSG00000005677
AA Change: D89G

Domain	Start	End	E-Value	Type
ZnF_C4	18	89	6.98e-35	SMART
low complexity region	94	110	N/A	INTRINSIC
HOLI	173	332	5.55e-29	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000133075

SMART Domains

Protein: ENSMUSP00000137852
Gene: ENSMUSG00000005677

Domain	Start	End	E-Value	Type
ZnF_C4	18	58	1.68e-3	SMART
low complexity region	80	93	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149404

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137298

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152865

Predicted Effect

probably benign
Transcript: ENSMUST00000155126

SMART Domains

Protein: ENSMUSP00000137683
Gene: ENSMUSG00000005677

Domain	Start	End	E-Value	Type
HOLI	36	196	5.55e-29	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143405

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nuclear receptor superfamily, and is a key regulator of xenobiotic and endobiotic metabolism. The protein binds to DNA as a monomer or a heterodimer with the retinoid X receptor and regulates the transcription of target genes involved in drug metabolism and bilirubin clearance, such as cytochrome P450 family members. Unlike most nuclear receptors, this transcriptional regulator is constitutively active in the absence of ligand but is regulated by both agonists and inverse agonists. Ligand binding results in translocation of this protein to the nucleus, where it activates or represses target gene transcription. These ligands include bilirubin, a variety of foreign compounds, steroid hormones, and prescription drugs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased sensitivity to TCPOBOP. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn3	T	C	19: 4,917,986 (GRCm39)	E327G	possibly damaging	Het
Cd209d	T	G	8: 3,928,320 (GRCm39)	M22L	probably benign	Het
Chrna2	T	C	14: 66,380,956 (GRCm39)	V75A	probably damaging	Het
Cnst	A	G	1: 179,450,462 (GRCm39)	E642G	possibly damaging	Het
Diaph1	A	G	18: 38,024,125 (GRCm39)	V571A	unknown	Het
Dip2c	C	A	13: 9,672,689 (GRCm39)	H1032N	probably damaging	Het
Eif4a3l1	A	T	6: 136,306,694 (GRCm39)	D385V	probably damaging	Het
Fbxl3	T	C	14: 103,333,012 (GRCm39)		probably benign	Het
Glb1	T	C	9: 114,263,529 (GRCm39)		probably null	Het
Gm8220	T	C	14: 44,525,634 (GRCm39)	I101T	probably benign	Het
Grin2b	A	G	6: 136,021,281 (GRCm39)	C7R	possibly damaging	Het
Myo15a	T	C	11: 60,384,409 (GRCm39)	I516T	probably damaging	Het
Ogfod1	T	G	8: 94,781,876 (GRCm39)		probably benign	Het
Or4k2	G	T	14: 50,424,230 (GRCm39)	S148*	probably null	Het
Pard3	G	T	8: 128,142,224 (GRCm39)	D930Y	probably damaging	Het
Pde7b	C	T	10: 20,494,932 (GRCm39)	C9Y	probably damaging	Het
Pilra	T	A	5: 137,829,488 (GRCm39)	D192V	probably damaging	Het
Ptprj	A	G	2: 90,301,605 (GRCm39)	S176P	probably benign	Het
Slc4a2	T	C	5: 24,640,633 (GRCm39)	V685A	possibly damaging	Het
Srxn1	G	A	2: 151,947,799 (GRCm39)	V66M	probably damaging	Het
Stox2	A	G	8: 47,740,951 (GRCm39)	F44L	possibly damaging	Het
Tlr11	T	C	14: 50,598,337 (GRCm39)	F108L	probably benign	Het
Ttn	T	A	2: 76,585,168 (GRCm39)	I22042F	probably damaging	Het
Ttn	A	C	2: 76,638,450 (GRCm39)	I13943M	probably damaging	Het
Wdfy4	T	C	14: 32,710,856 (GRCm39)	D2577G	probably damaging	Het
Zyg11a	A	T	4: 108,040,929 (GRCm39)	F675I	probably damaging	Het

Other mutations in Nr1i3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01582:Nr1i3	APN	1	171,042,541 (GRCm39)	missense	possibly damaging	0.79
IGL02401:Nr1i3	APN	1	171,043,942 (GRCm39)	splice site	probably benign
IGL02964:Nr1i3	APN	1	171,041,964 (GRCm39)	missense	probably benign	0.00
election	UTSW	1	171,043,951 (GRCm39)	missense	probably damaging	0.99
R0023:Nr1i3	UTSW	1	171,044,900 (GRCm39)	missense	probably damaging	0.99
R0049:Nr1i3	UTSW	1	171,041,982 (GRCm39)	missense	probably damaging	1.00
R0049:Nr1i3	UTSW	1	171,041,982 (GRCm39)	missense	probably damaging	1.00
R0504:Nr1i3	UTSW	1	171,044,805 (GRCm39)	splice site	probably benign
R1437:Nr1i3	UTSW	1	171,044,710 (GRCm39)	frame shift	probably null
R1754:Nr1i3	UTSW	1	171,044,963 (GRCm39)	missense	probably damaging	1.00
R1893:Nr1i3	UTSW	1	171,044,792 (GRCm39)	critical splice donor site	probably null
R2116:Nr1i3	UTSW	1	171,046,163 (GRCm39)	missense	probably damaging	1.00
R3613:Nr1i3	UTSW	1	171,042,564 (GRCm39)	nonsense	probably null
R3787:Nr1i3	UTSW	1	171,041,994 (GRCm39)	missense	probably damaging	1.00
R4627:Nr1i3	UTSW	1	171,044,014 (GRCm39)	missense	probably benign	0.00
R4772:Nr1i3	UTSW	1	171,044,719 (GRCm39)	missense	probably damaging	1.00
R4792:Nr1i3	UTSW	1	171,046,164 (GRCm39)	missense	probably damaging	0.99
R4880:Nr1i3	UTSW	1	171,043,951 (GRCm39)	missense	probably damaging	0.99
R5072:Nr1i3	UTSW	1	171,044,382 (GRCm39)	missense	probably benign	0.11
R5527:Nr1i3	UTSW	1	171,041,921 (GRCm39)	missense	possibly damaging	0.91
R6768:Nr1i3	UTSW	1	171,044,966 (GRCm39)	missense	probably damaging	1.00
R6824:Nr1i3	UTSW	1	171,042,542 (GRCm39)	missense	probably benign	0.00
R7011:Nr1i3	UTSW	1	171,041,927 (GRCm39)	missense	probably benign	0.02
R7092:Nr1i3	UTSW	1	171,041,747 (GRCm39)	splice site	probably null
R7740:Nr1i3	UTSW	1	171,044,396 (GRCm39)	missense	probably benign	0.00
R8200:Nr1i3	UTSW	1	171,045,266 (GRCm39)	missense	probably benign	0.44
R9013:Nr1i3	UTSW	1	171,042,026 (GRCm39)	missense	probably damaging	1.00
R9185:Nr1i3	UTSW	1	171,043,955 (GRCm39)	missense	possibly damaging	0.72
R9801:Nr1i3	UTSW	1	171,045,252 (GRCm39)	missense	probably damaging	1.00
X0027:Nr1i3	UTSW	1	171,041,946 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCCATCTAAAACCATGCAGTG -3'
(R):5'- CTATGAGGTGACAGGTTGTATGTAC -3'

Sequencing Primer
(F):5'- AACCATGCAGTGCCTGTC -3'
(R):5'- CACTTGATCTTGCAGAGAACCTGG -3'

Posted On

2017-12-01