Incidental Mutation 'R0130:Olfr992'
ID50098
Institutional Source Beutler Lab
Gene Symbol Olfr992
Ensembl Gene ENSMUSG00000075221
Gene Nameolfactory receptor 992
SynonymsMOR203-1, GA_x6K02T2Q125-46877170-46876241
MMRRC Submission 038415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0130 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location85398824-85409469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85399961 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 191 (S191C)
Ref Sequence ENSEMBL: ENSMUSP00000149333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099927] [ENSMUST00000213749] [ENSMUST00000214895] [ENSMUST00000215617]
Predicted Effect probably damaging
Transcript: ENSMUST00000099927
AA Change: S191C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097511
Gene: ENSMUSG00000075221
AA Change: S191C

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.3e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 285 3.3e-6 PFAM
Pfam:7tm_1 41 290 7.1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213749
AA Change: S191C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000214895
AA Change: S191C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000215617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215967
Meta Mutation Damage Score 0.0324 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.7%
  • 10x: 93.4%
  • 20x: 80.2%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A T 17: 84,686,666 Y37F probably damaging Het
Ablim2 G A 5: 35,809,176 probably benign Het
Anxa9 A G 3: 95,302,422 S129P probably benign Het
Apol7c A G 15: 77,526,362 I128T possibly damaging Het
Arfgef2 T G 2: 166,835,719 I88S probably damaging Het
Arfip2 A G 7: 105,638,998 probably benign Het
Atp5j2 A T 5: 145,188,182 probably benign Het
Atp7b C T 8: 22,028,172 E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 probably null Het
Cd22 A G 7: 30,869,964 Y402H possibly damaging Het
Cd248 A G 19: 5,069,962 T613A probably benign Het
Cdcp2 C T 4: 107,106,707 probably benign Het
Cenpc1 A T 5: 86,046,546 D120E probably benign Het
Chd3 T A 11: 69,359,830 H691L probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cped1 T A 6: 22,121,039 Y373N probably benign Het
Cr2 A T 1: 195,166,231 V328D probably damaging Het
Ctnnd2 A T 15: 30,921,913 E895V probably damaging Het
D630045J12Rik A T 6: 38,149,771 probably benign Het
Dcdc2a A T 13: 25,187,672 probably benign Het
Dync1h1 C A 12: 110,618,674 T837K probably benign Het
Eif2ak3 C A 6: 70,881,732 probably benign Het
Epb41l5 A C 1: 119,549,902 V705G possibly damaging Het
Fat2 T A 11: 55,252,118 M4302L probably benign Het
Flnb T C 14: 7,901,951 V938A probably damaging Het
Frmd4a T C 2: 4,604,092 Y928H probably damaging Het
Fyn C T 10: 39,511,982 T78M probably benign Het
Gdap2 A G 3: 100,201,995 T443A probably damaging Het
Gde1 A T 7: 118,695,060 F63L probably benign Het
Gjc3 A G 5: 137,957,940 S28P probably benign Het
Gm10250 G A 15: 5,120,991 probably null Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Klhl23 T C 2: 69,833,966 V553A probably damaging Het
Lman2l G T 1: 36,424,864 S171* probably null Het
Lrp1b T C 2: 41,511,508 D378G probably damaging Het
Map3k11 T C 19: 5,690,815 L190P probably damaging Het
Mki67 T A 7: 135,696,459 Q2282L probably damaging Het
Mthfd2 T A 6: 83,309,008 I272F probably damaging Het
Myom1 A T 17: 71,045,755 D358V probably damaging Het
Nebl T A 2: 17,393,023 Q487H possibly damaging Het
Nebl T C 2: 17,390,926 probably benign Het
Nlrp2 T A 7: 5,322,418 N14Y possibly damaging Het
Olfr1090 T C 2: 86,753,887 M284V probably benign Het
Olfr304 T C 7: 86,386,306 Y118C probably damaging Het
Olfr339 T A 2: 36,422,287 D296E probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Paxip1 C T 5: 27,744,185 probably benign Het
Pclo A G 5: 14,679,797 probably benign Het
Pld2 T G 11: 70,554,348 N591K probably benign Het
Plekha7 A G 7: 116,170,704 M276T probably damaging Het
Prss39 T A 1: 34,502,200 probably benign Het
Prtg A G 9: 72,809,716 Y113C probably damaging Het
Rab38 T A 7: 88,450,541 I88N probably damaging Het
Rbfox2 A G 15: 77,091,857 probably benign Het
Samd5 A G 10: 9,674,939 W9R probably damaging Het
Sec14l1 A T 11: 117,156,407 K637I possibly damaging Het
Sh2b1 A T 7: 126,471,448 D360E possibly damaging Het
Sh3bp4 A G 1: 89,145,314 N628S possibly damaging Het
Sim1 A T 10: 50,907,961 I104F probably damaging Het
Smcp T A 3: 92,584,520 T7S unknown Het
Sp4 A G 12: 118,300,816 probably benign Het
Tectb G T 19: 55,181,961 K81N probably damaging Het
Thbs4 G T 13: 92,754,410 H850N probably benign Het
Tiam1 T C 16: 89,897,754 M272V probably benign Het
Trav13-3 T A 14: 53,729,776 noncoding transcript Het
Ubap2l A T 3: 90,021,373 S478T possibly damaging Het
Vmn2r85 A G 10: 130,419,185 probably benign Het
Other mutations in Olfr992
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Olfr992 APN 2 85400171 missense probably damaging 1.00
IGL02538:Olfr992 APN 2 85400303 missense probably damaging 1.00
IGL02550:Olfr992 APN 2 85399822 missense probably damaging 0.99
R0128:Olfr992 UTSW 2 85399961 missense probably damaging 0.99
R0345:Olfr992 UTSW 2 85400341 missense possibly damaging 0.60
R0413:Olfr992 UTSW 2 85399675 missense probably damaging 1.00
R0535:Olfr992 UTSW 2 85400095 missense possibly damaging 0.71
R1243:Olfr992 UTSW 2 85400273 missense probably benign
R1255:Olfr992 UTSW 2 85400303 missense probably damaging 1.00
R1293:Olfr992 UTSW 2 85400353 splice site probably null
R1840:Olfr992 UTSW 2 85400168 missense probably benign 0.42
R1847:Olfr992 UTSW 2 85400441 missense probably damaging 0.99
R2300:Olfr992 UTSW 2 85400132 missense probably benign
R4574:Olfr992 UTSW 2 85400026 missense probably damaging 1.00
R4872:Olfr992 UTSW 2 85400428 missense probably damaging 1.00
R5435:Olfr992 UTSW 2 85400470 missense probably benign 0.05
R6846:Olfr992 UTSW 2 85400517 missense probably damaging 1.00
R7075:Olfr992 UTSW 2 85400200 missense probably damaging 1.00
R7253:Olfr992 UTSW 2 85399639 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGCCTCAGGGCTTCTATCACATC -3'
(R):5'- GAGACTCTGCATTTTGCTGCTGC -3'

Sequencing Primer
(F):5'- GTGTTCCATAGAATATGGTGACAGC -3'
(R):5'- GCTGCTGCTTGGTTCATACAC -3'
Posted On2013-06-12