Incidental Mutation 'R5391:Rasl12'
ID500990
Institutional Source Beutler Lab
Gene Symbol Rasl12
Ensembl Gene ENSMUSG00000041696
Gene NameRAS-like, family 12
Synonyms
MMRRC Submission 042963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5391 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location65398506-65414853 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 65398667 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 35 (A35S)
Ref Sequence ENSEMBL: ENSMUSP00000131837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085453] [ENSMUST00000165682] [ENSMUST00000217172]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085453
AA Change: A35S

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000082580
Gene: ENSMUSG00000041696
AA Change: A35S

DomainStartEndE-ValueType
Pfam:Arf 15 154 4e-7 PFAM
Pfam:Roc 22 138 1.5e-8 PFAM
Pfam:Ras 22 185 9.7e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165682
AA Change: A35S

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131837
Gene: ENSMUSG00000041696
AA Change: A35S

DomainStartEndE-ValueType
Pfam:Arf 15 155 3.9e-8 PFAM
Pfam:Miro 22 137 9.2e-14 PFAM
Pfam:Ras 22 159 1.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215605
Predicted Effect probably benign
Transcript: ENSMUST00000217172
AA Change: D35Y

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,805,481 M38I probably null Het
Actl7a A G 4: 56,743,661 T63A probably benign Het
Amfr G A 8: 93,976,048 P497S probably damaging Het
Ankrd33b T C 15: 31,325,206 I122V probably damaging Het
Asap1 G T 15: 64,094,052 T1011K possibly damaging Het
Cbfa2t3 G A 8: 122,633,395 R506* probably null Het
Ccdc105 G A 10: 78,752,854 Q41* probably null Het
Ccs C G 19: 4,833,482 C96S probably benign Het
Cpt1a A G 19: 3,349,260 D20G probably damaging Het
Ctdspl2 G A 2: 122,004,148 probably null Het
Dhx57 T C 17: 80,275,081 Y365C probably damaging Het
Dnah3 C T 7: 120,090,076 M38I probably benign Het
Dnajc6 T C 4: 101,628,158 probably null Het
Elac2 A G 11: 64,994,294 S450G probably benign Het
Gdf9 T C 11: 53,433,797 V131A probably benign Het
Il12rb2 T C 6: 67,292,420 N803S probably benign Het
Itgb4 T A 11: 115,985,068 M477K probably benign Het
Itgb8 A C 12: 119,170,741 C530W probably damaging Het
Krt78 C A 15: 101,951,828 E218* probably null Het
Lpar1 A G 4: 58,486,902 L105P probably damaging Het
Megf8 G A 7: 25,340,289 G936D possibly damaging Het
Mov10 G A 3: 104,802,533 H346Y probably benign Het
Nfia A G 4: 97,783,301 I83V probably damaging Het
Olfr1453 G T 19: 13,027,786 A181E probably damaging Het
Olfr215 T C 6: 116,582,847 Y33C probably damaging Het
Pcdhgb6 T G 18: 37,742,587 I116S probably damaging Het
Pdcd6ip G T 9: 113,691,518 Q133K probably damaging Het
Phkb A G 8: 86,017,468 D582G probably damaging Het
Pik3cd A T 4: 149,659,131 V207E probably damaging Het
Ptov1 T C 7: 44,863,584 Q397R probably damaging Het
Rangap1 A G 15: 81,706,446 F482L probably benign Het
Rapgef1 T A 2: 29,737,965 N1052K probably damaging Het
Rnf169 A T 7: 99,935,160 probably null Het
Sec16a A G 2: 26,440,032 V657A possibly damaging Het
Sin3a G A 9: 57,105,673 R612H probably damaging Het
Six6 T A 12: 72,941,701 L216* probably null Het
Tbce T C 13: 14,005,965 I293M probably damaging Het
Tmem176a T C 6: 48,844,696 L204P probably damaging Het
Tmem87a A G 2: 120,362,877 probably null Het
Tns1 A T 1: 73,990,409 probably null Het
Usf3 T A 16: 44,217,463 S769T probably benign Het
Vmn2r82 A G 10: 79,356,657 T23A probably null Het
Vps26a A G 10: 62,456,747 *328Q probably null Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wwc2 A T 8: 47,863,871 I729K unknown Het
Zbtb44 A G 9: 31,053,305 probably null Het
Zfp800 A T 6: 28,242,993 S658T probably damaging Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Zfp935 G T 13: 62,454,818 Y189* probably null Het
Zkscan1 T A 5: 138,097,101 H203Q probably benign Het
Zkscan14 T C 5: 145,195,794 D309G probably benign Het
Other mutations in Rasl12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01942:Rasl12 APN 9 65408362 missense probably damaging 1.00
IGL02268:Rasl12 APN 9 65398664 missense probably damaging 1.00
IGL02293:Rasl12 APN 9 65408311 missense probably benign 0.02
R0755:Rasl12 UTSW 9 65410959 missense probably benign
R1334:Rasl12 UTSW 9 65410869 missense probably damaging 1.00
R2063:Rasl12 UTSW 9 65410824 missense probably damaging 1.00
R2872:Rasl12 UTSW 9 65408323 missense probably benign 0.10
R2872:Rasl12 UTSW 9 65408323 missense probably benign 0.10
R2874:Rasl12 UTSW 9 65408323 missense probably benign 0.10
R4456:Rasl12 UTSW 9 65398584 missense probably null 1.00
R4785:Rasl12 UTSW 9 65413448 missense probably damaging 0.99
R7008:Rasl12 UTSW 9 65410869 missense probably damaging 1.00
X0058:Rasl12 UTSW 9 65408329 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGACACCATAGTCTGAGTGAC -3'
(R):5'- CTGGTCCTAGGGATGCAGATAAG -3'

Sequencing Primer
(F):5'- ACTGGGGGCGTGCAACTAG -3'
(R):5'- GACAGGAGTCACAGGCACC -3'
Posted On2017-12-01