Incidental Mutation 'R5415:Rnf165'
ID501039
Institutional Source Beutler Lab
Gene Symbol Rnf165
Ensembl Gene ENSMUSG00000025427
Gene Namering finger protein 165
SynonymsG630064H08Rik, Ark2c, LOC225743, 2900024M11Rik
MMRRC Submission 042984-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R5415 (G1)
Quality Score202
Status Not validated
Chromosome18
Chromosomal Location77456110-77565147 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 77466739 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 60 (V60L)
Ref Sequence ENSEMBL: ENSMUSP00000138494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026494] [ENSMUST00000182024]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026494
AA Change: V253L

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000026494
Gene: ENSMUSG00000025427
AA Change: V253L

DomainStartEndE-ValueType
low complexity region 99 121 N/A INTRINSIC
RING 295 335 1.4e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182024
AA Change: V60L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138494
Gene: ENSMUSG00000025427
AA Change: V60L

DomainStartEndE-ValueType
RING 102 142 1.4e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000182153
AA Change: V200L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182805
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Encoded in regions involved in pericentric inversions in patients with bipolar affective disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial neonatal lethality followed by complete postnatal lethality, growth retardation, abnormal joint mobility, cyanosis, abnormal motor neuron innervation pattern and abnormal phrenic nerve innervation pattern to diaphragm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,926,065 D260E probably benign Het
A430078G23Rik G A 8: 3,388,075 R303H probably damaging Het
Asb15 A T 6: 24,570,691 Q556L probably benign Het
Ccr1 G T 9: 123,964,376 P39H probably damaging Het
Cd177 A T 7: 24,752,391 L400Q probably damaging Het
Cideb T C 14: 55,757,855 E58G probably damaging Het
Drd2 A G 9: 49,402,253 K241E possibly damaging Het
Ect2 C T 3: 27,146,853 C126Y probably damaging Het
Eef1d T C 15: 75,903,181 T210A probably benign Het
Enpp2 G A 15: 54,882,156 H315Y probably damaging Het
Ero1lb A T 13: 12,601,767 M362L probably benign Het
Exosc2 A G 2: 31,672,566 K73E possibly damaging Het
Gm9637 T A 14: 19,402,143 noncoding transcript Het
Gstm5 A G 3: 107,897,495 D101G probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kmt2c T C 5: 25,314,701 D2137G probably benign Het
Mecom T C 3: 29,957,526 D619G possibly damaging Het
Met A G 6: 17,527,085 I512V probably benign Het
Myh15 A G 16: 49,117,295 K753R probably null Het
Nfatc4 A G 14: 55,832,634 D753G probably benign Het
Olfr1218 T A 2: 89,054,896 T177S probably benign Het
Olfr1259 T A 2: 89,943,387 T243S probably benign Het
Olfr167 T A 16: 19,515,246 H130L possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp9 C T 16: 35,943,382 A10V probably damaging Het
Pcdh8 C A 14: 79,770,248 E292* probably null Het
Pdpn A T 4: 143,269,218 V161D probably damaging Het
Peg3 A G 7: 6,708,629 V1198A probably benign Het
Phykpl T C 11: 51,585,515 S21P probably benign Het
Plcb1 G T 2: 135,347,402 V817F possibly damaging Het
Polk T C 13: 96,483,955 Y579C probably benign Het
Ppp1r18 A G 17: 35,867,619 N129D probably benign Het
Psg29 C A 7: 17,211,636 probably null Het
Rims4 C T 2: 163,918,676 R3H probably benign Het
Rps6kl1 A T 12: 85,139,381 C292S probably benign Het
Uaca G T 9: 60,870,139 G603C possibly damaging Het
Vmn1r60 T C 7: 5,544,417 H228R probably benign Het
Vmn2r7 T C 3: 64,716,237 T221A probably benign Het
Zfp647 C A 15: 76,911,393 V356L possibly damaging Het
Other mutations in Rnf165
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Rnf165 APN 18 77462914 missense probably damaging 1.00
IGL02014:Rnf165 APN 18 77468359 missense probably damaging 0.99
IGL03210:Rnf165 APN 18 77466739 missense probably damaging 1.00
R0486:Rnf165 UTSW 18 77484254 missense probably damaging 0.97
R1523:Rnf165 UTSW 18 77462938 missense probably benign 0.17
R1650:Rnf165 UTSW 18 77462417 unclassified probably null
R1853:Rnf165 UTSW 18 77462975 missense possibly damaging 0.68
R3402:Rnf165 UTSW 18 77565086 missense probably benign 0.02
R5039:Rnf165 UTSW 18 77462912 missense probably damaging 1.00
R5875:Rnf165 UTSW 18 77563181 intron probably benign
R6544:Rnf165 UTSW 18 77563235 intron probably benign
X0067:Rnf165 UTSW 18 77462950 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGTAGAACACGGAACCAG -3'
(R):5'- ATGAGGTATGTTGCCCTGAAGG -3'

Sequencing Primer
(F):5'- CAGAACAAAGGCCCCTGGG -3'
(R):5'- GGGCACCGACTTCATTCC -3'
Posted On2017-12-01