Incidental Mutation 'R5437:Dctn5'
ID501049
Institutional Source Beutler Lab
Gene Symbol Dctn5
Ensembl Gene ENSMUSG00000030868
Gene Namedynactin 5
Synonymsp25 dynactin subunit, 4930427E12Rik, b2b315Clo
MMRRC Submission 043002-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5437 (G1)
Quality Score51
Status Validated
Chromosome7
Chromosomal Location122133041-122149044 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to A at 122133329 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033156] [ENSMUST00000063587] [ENSMUST00000098068] [ENSMUST00000106468] [ENSMUST00000106469] [ENSMUST00000142952] [ENSMUST00000176193]
Predicted Effect probably benign
Transcript: ENSMUST00000033156
SMART Domains Protein: ENSMUSP00000033156
Gene: ENSMUSG00000030868

DomainStartEndE-ValueType
Pfam:Hexapep 84 118 1.3e-6 PFAM
Pfam:Hexapep 100 130 7.5e-7 PFAM
Pfam:Hexapep 107 142 7.7e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063587
SMART Domains Protein: ENSMUSP00000063514
Gene: ENSMUSG00000044702

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
PDB:3EU7|A 36 383 N/A PDB
SCOP:d2bbkh_ 231 381 4e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098068
SMART Domains Protein: ENSMUSP00000095675
Gene: ENSMUSG00000044702

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 415 431 N/A INTRINSIC
low complexity region 446 462 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 543 559 N/A INTRINSIC
Pfam:PALB2_WD40 755 1102 2.4e-183 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106468
SMART Domains Protein: ENSMUSP00000102076
Gene: ENSMUSG00000044702

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 415 431 N/A INTRINSIC
low complexity region 446 462 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 543 559 N/A INTRINSIC
PDB:3EU7|A 753 984 1e-131 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000106469
SMART Domains Protein: ENSMUSP00000102077
Gene: ENSMUSG00000044702

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 180 196 N/A INTRINSIC
PDB:3EU7|A 390 740 N/A PDB
SCOP:d2bbkh_ 588 738 3e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130149
SMART Domains Protein: ENSMUSP00000121994
Gene: ENSMUSG00000044702

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 415 431 N/A INTRINSIC
low complexity region 446 462 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162843
Predicted Effect probably benign
Transcript: ENSMUST00000176193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205352
Meta Mutation Damage Score 0.6516 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of dynactin, a component of the cytoplasmic dynein motor machinery involved in minus-end-directed transport. The encoded protein is a component of the pointed-end subcomplex and is thought to bind membranous cargo. A pseudogene of this gene is located on the long arm of chromosome 1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit double outlet right ventricle (DORV), overriding aorta, and ventricular septal defect (VSD). Micrognathia, microcephaly/anencephaly and holoprosencephaly are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,319,796 Q186* probably null Het
Acaca G A 11: 84,346,820 probably null Het
Acsm3 C A 7: 119,778,497 probably benign Het
Aoc1 C A 6: 48,907,750 Q576K probably benign Het
Atp6v0a4 T A 6: 38,076,733 N378I probably damaging Het
BC003331 T G 1: 150,363,518 I385L probably benign Het
Cacna1i A T 15: 80,371,529 H871L probably damaging Het
Clic4 C G 4: 135,217,246 R206P probably damaging Het
Commd9 G A 2: 101,901,028 G186D probably damaging Het
Cpne9 C T 6: 113,304,630 probably benign Het
Crhr2 C T 6: 55,100,733 V196I probably damaging Het
Dhtkd1 C T 2: 5,924,119 R247Q probably benign Het
Dmrta1 G A 4: 89,691,756 G318R possibly damaging Het
Dpp6 T A 5: 27,663,501 Y487* probably null Het
Eef1akmt3 A T 10: 127,033,247 N119K probably damaging Het
Eloa A T 4: 136,012,885 L75Q probably damaging Het
Fat3 G A 9: 16,085,308 T1202M probably damaging Het
Fcho2 A G 13: 98,777,474 I205T possibly damaging Het
Fkbp10 A C 11: 100,421,023 D174A probably damaging Het
Gcnt2 T A 13: 40,861,176 F274L probably damaging Het
Gtf3c1 A T 7: 125,667,368 C969S probably damaging Het
Hook3 T C 8: 26,061,422 E130G probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Itsn1 T A 16: 91,818,591 probably benign Het
Kif13b C T 14: 64,806,114 R1788C probably damaging Het
Kif3a C T 11: 53,598,726 S135F probably damaging Het
Klf5 C T 14: 99,301,459 R23* probably null Het
Lcn5 A G 2: 25,658,011 I11V probably benign Het
Mpp7 A T 18: 7,458,930 probably null Het
Mroh5 T C 15: 73,787,969 I338V probably benign Het
Mthfd2l A G 5: 90,948,898 N126S possibly damaging Het
Myo18b G T 5: 112,757,573 A2053E possibly damaging Het
Naip6 A T 13: 100,303,304 C318* probably null Het
Ndufs7 C T 10: 80,254,924 R116C possibly damaging Het
Olfr1378 T C 11: 50,969,108 M30T probably benign Het
Pnkd T C 1: 74,349,737 V214A possibly damaging Het
Popdc2 T G 16: 38,362,901 V82G probably benign Het
Prkdc A T 16: 15,769,875 L2541F possibly damaging Het
Ptpn9 A T 9: 57,020,037 H66L possibly damaging Het
Pygm T A 19: 6,390,382 N397K probably damaging Het
Rabgap1l T A 1: 160,722,147 E324D probably damaging Het
Rnf6 G A 5: 146,210,280 R643C probably damaging Het
Ryr2 C T 13: 11,655,713 V3466M probably damaging Het
Scn7a A G 2: 66,676,346 Y1400H probably damaging Het
Sept10 T A 10: 59,176,959 N279I probably damaging Het
Sh3rf2 A T 18: 42,141,014 Y415F probably benign Het
Sorcs1 T C 19: 50,252,602 T449A probably benign Het
Tcam1 C T 11: 106,285,423 T325M probably damaging Het
Tctn1 A G 5: 122,258,879 I147T probably benign Het
Tet1 G T 10: 62,814,451 H30Q probably benign Het
Tmem109 A G 19: 10,872,014 I159T probably damaging Het
Tmem40 C T 6: 115,759,031 probably benign Het
Tnfrsf21 C T 17: 43,037,862 P122S possibly damaging Het
Uaca A G 9: 60,871,451 D1038G probably benign Het
Ubr2 C G 17: 46,963,697 E852D probably benign Het
Ubr3 A T 2: 69,944,390 N518I probably damaging Het
Unc80 T G 1: 66,654,578 L2596R possibly damaging Het
Zcchc3 G A 2: 152,414,732 P16S probably benign Het
Other mutations in Dctn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00548:Dctn5 APN 7 122143796 nonsense probably null
IGL02110:Dctn5 APN 7 122135151 missense probably damaging 1.00
IGL03102:Dctn5 APN 7 122133159 missense probably benign
R4458:Dctn5 UTSW 7 122135080 missense probably damaging 1.00
R5540:Dctn5 UTSW 7 122135052 missense probably benign 0.19
R6027:Dctn5 UTSW 7 122133341 splice site probably benign
R6112:Dctn5 UTSW 7 122133237 unclassified probably benign
R6499:Dctn5 UTSW 7 122135097 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGTCGGAGTACATCGAGACG -3'
(R):5'- TCTTAGCACGTAAGCAGACTGTG -3'

Sequencing Primer
(F):5'- CATCGAGACGGTGCGCG -3'
(R):5'- TTTTTAAAAAGGGCCCGGAGTC -3'
Posted On2017-12-01