Incidental Mutation 'R5455:Opalin'
ID501065
Institutional Source Beutler Lab
Gene Symbol Opalin
Ensembl Gene ENSMUSG00000050121
Gene Nameoligodendrocytic myelin paranodal and inner loop protein
SynonymsTmem10, Tmp10
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5455 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location41062474-41077113 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41069953 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 14 (T14A)
Ref Sequence ENSEMBL: ENSMUSP00000084422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087176]
Predicted Effect probably benign
Transcript: ENSMUST00000087176
AA Change: T14A

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000084422
Gene: ENSMUSG00000050121
AA Change: T14A

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
transmembrane domain 31 53 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,536,516 probably null Het
Adgrf1 T A 17: 43,321,143 probably null Het
Ascc3 T C 10: 50,849,583 V2134A probably benign Het
Cct6b T G 11: 82,755,117 I80L probably benign Het
Crebbp C A 16: 4,085,967 V1765L probably benign Het
Cul9 C T 17: 46,510,846 probably null Het
Cyp2c40 A G 19: 39,803,792 I236T possibly damaging Het
Dbndd2 C A 2: 164,490,193 T112K possibly damaging Het
Dmrtc2 A C 7: 24,872,491 S4R probably benign Het
Dnah6 C T 6: 73,075,734 V2988I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Ercc3 T C 18: 32,267,209 S705P possibly damaging Het
Gm10306 T G 4: 94,556,840 probably benign Het
H2-Q6 T C 17: 35,424,884 L3P unknown Het
Kcnn4 T C 7: 24,377,553 S176P probably damaging Het
Maml2 T A 9: 13,705,743 Y128* probably null Het
Map2 G A 1: 66,399,391 E25K probably damaging Het
Morc2b T A 17: 33,138,610 M63L probably benign Het
Mthfd1 A G 12: 76,301,288 I569V probably benign Het
Myh8 G A 11: 67,301,418 R1399H possibly damaging Het
Nop2 T C 6: 125,140,643 I424T probably benign Het
Olfm5 T C 7: 104,154,462 R265G probably damaging Het
Olfr1352 C T 10: 78,984,537 S249F possibly damaging Het
Olfr1406 A G 1: 173,184,251 F61S probably damaging Het
Pced1b C A 15: 97,384,393 S104R probably benign Het
Pdia2 T G 17: 26,197,163 Q310P probably null Het
Ppil6 A G 10: 41,498,545 T141A probably benign Het
Prrc2b A G 2: 32,221,343 probably null Het
Stxbp5 A G 10: 9,808,508 S573P probably benign Het
Synpo2l C A 14: 20,662,292 A87S probably damaging Het
Tor1b GGACG GG 2: 30,956,945 probably benign Het
Vmn1r89 A T 7: 13,220,267 H121L probably benign Het
Vmn2r99 T A 17: 19,394,146 C709* probably null Het
Vstm4 A G 14: 32,863,878 H134R possibly damaging Het
Zan C T 5: 137,454,000 C1569Y unknown Het
Zdhhc13 A G 7: 48,805,575 T122A possibly damaging Het
Zpbp2 G T 11: 98,557,603 V249L probably benign Het
Other mutations in Opalin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01694:Opalin APN 19 41063800 unclassified probably benign
IGL02025:Opalin APN 19 41072235 splice site probably benign
IGL02282:Opalin APN 19 41066504 missense probably benign 0.40
IGL02878:Opalin APN 19 41067669 missense probably benign 0.19
R0881:Opalin UTSW 19 41063981 critical splice acceptor site probably null
R1781:Opalin UTSW 19 41067631 intron probably null
R4579:Opalin UTSW 19 41067757 missense probably damaging 0.98
R5470:Opalin UTSW 19 41066531 missense probably benign 0.34
R7161:Opalin UTSW 19 41069935 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- ATTGAGTCTAGTCCCGGGCTTG -3'
(R):5'- TGATTCACCGGGTCAATAGTG -3'

Sequencing Primer
(F):5'- TTGAGGACAGCTCCCAAGTC -3'
(R):5'- CATGAAGCCTAATTTCACTCTGG -3'
Posted On2017-12-01