Incidental Mutation 'R5467:Mgl2'
ID501075
Institutional Source Beutler Lab
Gene Symbol Mgl2
Ensembl Gene ENSMUSG00000040950
Gene Namemacrophage galactose N-acetyl-galactosamine specific lectin 2
SynonymsCD301b
MMRRC Submission 043028-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5467 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location70130329-70137550 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70135052 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 31 (I31N)
Ref Sequence ENSEMBL: ENSMUSP00000104225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041550] [ENSMUST00000108584] [ENSMUST00000165951]
Predicted Effect probably benign
Transcript: ENSMUST00000041550
AA Change: I37N

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000048568
Gene: ENSMUSG00000040950
AA Change: I37N

DomainStartEndE-ValueType
Pfam:Lectin_N 6 179 4.6e-56 PFAM
CLECT 189 313 2.37e-35 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108584
AA Change: I31N

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104225
Gene: ENSMUSG00000040950
AA Change: I31N

DomainStartEndE-ValueType
Pfam:Lectin_N 8 173 8.6e-56 PFAM
CLECT 183 355 5.76e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147502
Predicted Effect probably benign
Transcript: ENSMUST00000165951
AA Change: V38D

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000131344
Gene: ENSMUSG00000040950
AA Change: V38D

DomainStartEndE-ValueType
Pfam:Lectin_N 21 133 2.1e-35 PFAM
Pfam:Lectin_N 129 180 5.4e-19 PFAM
CLECT 190 362 5.76e-25 SMART
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 94.9%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that are either homozygous or heterozygous for a reporter allele are viable and fertile. In heterozygotes, transient depletion of CD301b+ dermal dendritic cells by injection of diptheria toxin results in impaired T helper 2 (Th2) cell mediated immunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,176,217 M525T possibly damaging Het
Arpc5l T C 2: 39,013,739 V80A possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Celsr3 A T 9: 108,828,637 D773V probably damaging Het
Clcn6 A T 4: 148,017,636 H330Q possibly damaging Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
D430042O09Rik T C 7: 125,843,355 F812S possibly damaging Het
Dmbt1 C A 7: 131,040,993 S180R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dusp27 C A 1: 166,112,030 probably null Het
Elovl7 T C 13: 108,279,622 V182A probably benign Het
Eml3 G A 19: 8,937,582 W601* probably null Het
Farp1 C T 14: 121,235,077 P208L probably damaging Het
Fras1 A T 5: 96,780,053 Y3775F probably benign Het
Gm884 G T 11: 103,603,265 C655* probably null Het
Gns T C 10: 121,391,446 W454R probably benign Het
Kcnh2 A T 5: 24,326,767 L40* probably null Het
Kmt2d G A 15: 98,852,109 probably benign Het
Muc6 T C 7: 141,636,535 T2677A possibly damaging Het
Ndst1 A G 18: 60,692,021 S742P probably benign Het
Olfr108 G T 17: 37,446,082 C187F probably damaging Het
Olfr1428 A C 19: 12,108,659 S70A probably benign Het
Olfr1466 A T 19: 13,342,157 Y133F probably damaging Het
Olfr935 T C 9: 38,994,904 Y177C probably benign Het
Olfr981 G T 9: 40,022,437 V15L probably benign Het
Pcdhb22 A G 18: 37,520,135 D552G probably benign Het
Pikfyve T A 1: 65,252,495 V1291E probably damaging Het
Ppp4r3a T C 12: 101,043,470 E636G probably damaging Het
Prl5a1 A T 13: 28,150,011 I166L possibly damaging Het
Rb1 T C 14: 73,211,620 D690G possibly damaging Het
Sh3tc2 A G 18: 61,990,688 H840R possibly damaging Het
Skida1 T C 2: 18,046,112 probably benign Het
Slc31a2 A G 4: 62,292,687 H19R probably damaging Het
Tnks2 A T 19: 36,881,776 R314W probably damaging Het
Trak1 A G 9: 121,446,798 D189G probably damaging Het
Trav13n-4 T A 14: 53,363,846 V24E probably damaging Het
Uhrf1bp1l G T 10: 89,805,099 G711W probably damaging Het
Ylpm1 T C 12: 84,996,859 Y124H unknown Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Mgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00677:Mgl2 APN 11 70137106 missense probably benign 0.33
IGL00757:Mgl2 APN 11 70135150 missense probably damaging 1.00
IGL00838:Mgl2 APN 11 70134212 missense probably benign 0.00
IGL01118:Mgl2 APN 11 70134189 missense probably benign 0.00
IGL01613:Mgl2 APN 11 70134158 missense probably benign 0.08
IGL02094:Mgl2 APN 11 70137097 missense possibly damaging 0.73
IGL03000:Mgl2 APN 11 70134200 nonsense probably null
R1893:Mgl2 UTSW 11 70134167 unclassified probably null
R3767:Mgl2 UTSW 11 70135833 missense probably damaging 1.00
R3768:Mgl2 UTSW 11 70135833 missense probably damaging 1.00
R3769:Mgl2 UTSW 11 70135833 missense probably damaging 1.00
R5742:Mgl2 UTSW 11 70136684 missense probably benign 0.00
R6018:Mgl2 UTSW 11 70137111 makesense probably null
R7189:Mgl2 UTSW 11 70137043 missense probably damaging 1.00
R7270:Mgl2 UTSW 11 70135680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAAACAATTACCTCTGGAAAGG -3'
(R):5'- CAATCACTGCCCAGGTTCTC -3'

Sequencing Primer
(F):5'- ACAGTTCCTCATGTTATGGTGAC -3'
(R):5'- AATCACTGCCCAGGTTCTCTTCTC -3'
Posted On2017-12-01