Incidental Mutation 'R5469:Cacna2d1'
ID501081
Institutional Source Beutler Lab
Gene Symbol Cacna2d1
Ensembl Gene ENSMUSG00000040118
Gene Namecalcium channel, voltage-dependent, alpha2/delta subunit 1
SynonymsCa(v)alpha2delta1, Cacna2, Cchl2a
MMRRC Submission 043030-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.490) question?
Stock #R5469 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location15934691-16374511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16352678 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 702 (I702N)
Ref Sequence ENSEMBL: ENSMUSP00000142881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039370] [ENSMUST00000078272] [ENSMUST00000101581] [ENSMUST00000115281] [ENSMUST00000167946] [ENSMUST00000180204] [ENSMUST00000199704]
Predicted Effect probably benign
Transcript: ENSMUST00000039370
AA Change: I726N

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000049457
Gene: ENSMUSG00000040118
AA Change: I726N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.3e-42 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 536 1e-31 PFAM
Pfam:VGCC_alpha2 562 655 1e-46 PFAM
low complexity region 675 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078272
AA Change: I707N

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000077391
Gene: ENSMUSG00000040118
AA Change: I707N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 1.1e-30 PFAM
Pfam:VGCC_alpha2 543 634 3.3e-53 PFAM
low complexity region 656 667 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101581
AA Change: I714N

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099117
Gene: ENSMUSG00000040118
AA Change: I714N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 1.1e-30 PFAM
Pfam:VGCC_alpha2 543 636 1.2e-59 PFAM
low complexity region 663 674 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115281
AA Change: I709N

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110936
Gene: ENSMUSG00000040118
AA Change: I709N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.2e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 3.8e-30 PFAM
Pfam:VGCC_alpha2 538 631 6.2e-60 PFAM
low complexity region 658 669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167946
AA Change: I714N

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131507
Gene: ENSMUSG00000040118
AA Change: I714N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 3.8e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 2.6e-30 PFAM
Pfam:VGCC_alpha2 543 636 5.5e-56 PFAM
low complexity region 663 674 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180204
AA Change: I709N

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000136260
Gene: ENSMUSG00000040118
AA Change: I709N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.2e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 3.8e-30 PFAM
Pfam:VGCC_alpha2 538 631 6.2e-60 PFAM
low complexity region 658 669 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199704
AA Change: I702N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142881
Gene: ENSMUSG00000040118
AA Change: I702N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 6.3e-30 PFAM
Pfam:VGCC_alpha2 538 629 3.3e-53 PFAM
low complexity region 651 662 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a regulatory component of the voltage-dependent calcium channel complex. The product of this gene is a proprotein that is proteolytically processed into alpha-2 and delta subunits, which are linked by a disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice with a point mutation allele exhibit abnormal CNS synaptic transmission and decreased response to pregabalin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Allc A T 12: 28,555,306 N331K probably benign Het
Anapc1 G T 2: 128,675,701 S341* probably null Het
Cacna1e T C 1: 154,443,937 E1339G probably damaging Het
Casp2 C A 6: 42,269,334 H209N probably benign Het
Casr A G 16: 36,510,030 V314A probably benign Het
Ccne2 A T 4: 11,201,353 R294* probably null Het
Cd180 T A 13: 102,704,834 H129Q probably benign Het
Chst10 A T 1: 38,865,527 Y362N probably damaging Het
Ctnna1 T A 18: 35,239,520 D509E probably benign Het
Ctsh G T 9: 90,060,511 probably null Het
Dhx29 C T 13: 112,944,539 A369V possibly damaging Het
Enox1 A G 14: 77,592,974 T340A probably benign Het
Fam135b T A 15: 71,446,043 T1357S probably benign Het
Flt3 A T 5: 147,355,083 S544T possibly damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gsap A T 5: 21,290,544 Y831F possibly damaging Het
Hnrnpr C T 4: 136,319,434 T142M probably damaging Het
Jak3 A G 8: 71,678,773 D94G probably benign Het
Ktn1 A T 14: 47,690,920 E579D probably damaging Het
Lama2 G A 10: 27,041,189 P2247S possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Mphosph10 A T 7: 64,389,445 probably null Het
Pappa C T 4: 65,205,152 T908M probably benign Het
Pdcd10 T A 3: 75,521,057 K150* probably null Het
Piezo2 A T 18: 63,027,864 I2275N probably damaging Het
Pmvk T C 3: 89,467,682 probably null Het
Pold2 G A 11: 5,873,048 P376S probably damaging Het
Prtg A T 9: 72,891,965 Q759L probably damaging Het
Rad51ap1 C T 6: 126,928,227 S107N probably damaging Het
Rfk T A 19: 17,395,202 N29K probably damaging Het
Ror2 T C 13: 53,117,339 M315V probably benign Het
Rrn3 A G 16: 13,813,100 E600G probably benign Het
Ryk A G 9: 102,906,954 Y593C possibly damaging Het
Slc30a3 T A 5: 31,088,660 D193V probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Srbd1 C A 17: 86,119,942 C421F possibly damaging Het
Sstr5 A C 17: 25,492,069 V62G probably damaging Het
Tfip11 G A 5: 112,334,325 W483* probably null Het
Tlk1 T C 2: 70,721,668 H553R probably benign Het
Tnc T C 4: 64,013,925 probably null Het
Trav12-1 A G 14: 53,538,473 T27A probably damaging Het
Usp9y G A Y: 1,364,714 T1033I probably benign Het
V1ra8 C T 6: 90,203,204 H130Y probably benign Het
Vmn2r77 A T 7: 86,802,063 M386L probably benign Het
Other mutations in Cacna2d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cacna2d1 APN 5 16212944 missense probably damaging 1.00
IGL00470:Cacna2d1 APN 5 16246656 splice site probably benign
IGL00495:Cacna2d1 APN 5 16370609 missense probably benign 0.05
IGL00538:Cacna2d1 APN 5 16246785 nonsense probably null
IGL00990:Cacna2d1 APN 5 15935069 missense probably benign 0.23
IGL01079:Cacna2d1 APN 5 16370648 missense probably benign 0.03
IGL01344:Cacna2d1 APN 5 16370631 missense probably benign 0.26
IGL01597:Cacna2d1 APN 5 16326392 splice site probably benign
IGL01645:Cacna2d1 APN 5 16012391 splice site probably null
IGL01959:Cacna2d1 APN 5 16212897 missense probably benign 0.00
IGL02397:Cacna2d1 APN 5 16320164 splice site probably benign
IGL03152:Cacna2d1 APN 5 16322568 missense probably benign 0.00
IGL03216:Cacna2d1 APN 5 16353842 missense probably damaging 0.98
IGL03374:Cacna2d1 APN 5 16356823 missense probably damaging 0.99
PIT4283001:Cacna2d1 UTSW 5 16302294 missense probably benign 0.31
PIT4585001:Cacna2d1 UTSW 5 16326344 missense probably damaging 1.00
R0158:Cacna2d1 UTSW 5 16361817 splice site probably benign
R0457:Cacna2d1 UTSW 5 16267416 missense probably damaging 1.00
R0477:Cacna2d1 UTSW 5 16194798 critical splice donor site probably null
R0483:Cacna2d1 UTSW 5 16359027 missense probably damaging 0.98
R0532:Cacna2d1 UTSW 5 16362273 missense probably benign 0.13
R0552:Cacna2d1 UTSW 5 16328043 missense probably damaging 1.00
R0924:Cacna2d1 UTSW 5 16365862 missense possibly damaging 0.79
R0930:Cacna2d1 UTSW 5 16365862 missense possibly damaging 0.79
R1144:Cacna2d1 UTSW 5 16322597 critical splice donor site probably null
R1164:Cacna2d1 UTSW 5 16361876 critical splice donor site probably null
R1398:Cacna2d1 UTSW 5 16357766 missense possibly damaging 0.47
R1440:Cacna2d1 UTSW 5 16355495 missense probably damaging 1.00
R1543:Cacna2d1 UTSW 5 16266718 missense possibly damaging 0.62
R1573:Cacna2d1 UTSW 5 16370627 missense probably damaging 1.00
R1633:Cacna2d1 UTSW 5 16320116 missense probably damaging 1.00
R1673:Cacna2d1 UTSW 5 16299990 missense probably damaging 1.00
R1750:Cacna2d1 UTSW 5 16264288 missense probably benign 0.01
R1753:Cacna2d1 UTSW 5 16302354 missense possibly damaging 0.95
R1966:Cacna2d1 UTSW 5 16333785 nonsense probably null
R2163:Cacna2d1 UTSW 5 16362319 missense probably damaging 1.00
R2258:Cacna2d1 UTSW 5 16357289 missense probably damaging 1.00
R2870:Cacna2d1 UTSW 5 16312568 missense probably damaging 1.00
R2870:Cacna2d1 UTSW 5 16312568 missense probably damaging 1.00
R4303:Cacna2d1 UTSW 5 16302248 intron probably null
R4804:Cacna2d1 UTSW 5 16359208 missense probably damaging 0.97
R5032:Cacna2d1 UTSW 5 16359070 missense probably damaging 1.00
R5080:Cacna2d1 UTSW 5 16362396 critical splice donor site probably null
R5466:Cacna2d1 UTSW 5 16246714 missense probably damaging 1.00
R5564:Cacna2d1 UTSW 5 16312519 missense probably damaging 1.00
R5655:Cacna2d1 UTSW 5 16302335 missense probably damaging 1.00
R5688:Cacna2d1 UTSW 5 16358952 missense probably damaging 0.99
R5729:Cacna2d1 UTSW 5 15935039 nonsense probably null
R6005:Cacna2d1 UTSW 5 16361821 missense probably damaging 1.00
R6343:Cacna2d1 UTSW 5 16322564 missense probably benign 0.09
R6485:Cacna2d1 UTSW 5 16354657 missense probably damaging 1.00
R6486:Cacna2d1 UTSW 5 16319450 unclassified probably null
R6625:Cacna2d1 UTSW 5 16362393 missense probably null 1.00
R6700:Cacna2d1 UTSW 5 16365460 missense probably damaging 1.00
R6706:Cacna2d1 UTSW 5 16326340 missense probably damaging 1.00
R6711:Cacna2d1 UTSW 5 16300041 missense probably damaging 1.00
R7025:Cacna2d1 UTSW 5 16352668 nonsense probably null
R7035:Cacna2d1 UTSW 5 16246672 missense probably damaging 1.00
R7086:Cacna2d1 UTSW 5 16349416 missense probably damaging 1.00
R7110:Cacna2d1 UTSW 5 16357784 missense probably damaging 0.99
R7268:Cacna2d1 UTSW 5 16370588 missense probably damaging 0.99
R7310:Cacna2d1 UTSW 5 16314916 missense probably damaging 1.00
R7471:Cacna2d1 UTSW 5 15934975 start gained probably benign
Z1088:Cacna2d1 UTSW 5 16194763 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACATTTTCTCTTAGTACTGACTGGC -3'
(R):5'- CTGGGTTACACTCACAACTGAAAATG -3'

Sequencing Primer
(F):5'- TCATGTCCACAATAAGTAAGACAAG -3'
(R):5'- GCAACTTATCAACAATTGCTAACGTG -3'
Posted On2017-12-01