Incidental Mutation 'R5530:Cubn'
ID 501086
Institutional Source Beutler Lab
Gene Symbol Cubn
Ensembl Gene ENSMUSG00000026726
Gene Name cubilin
Synonyms D2Wsu88e, intrinsic factor-cobalamin receptor
MMRRC Submission 043088-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5530 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 13281149-13496624 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 13313334 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 3079 (R3079W)
Ref Sequence ENSEMBL: ENSMUSP00000089009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091436]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000091436
AA Change: R3079W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: R3079W

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 132 165 2.14e-5 SMART
EGF_CA 167 208 1.95e-8 SMART
EGF 213 258 2.85e-1 SMART
EGF_CA 260 301 2.66e-10 SMART
EGF_CA 302 345 7.07e-6 SMART
EGF 349 393 1.01e-1 SMART
EGF 398 430 3.73e-5 SMART
EGF_CA 432 468 8.63e-10 SMART
CUB 474 586 4.4e-21 SMART
CUB 590 702 3.82e-39 SMART
CUB 708 816 3.66e-18 SMART
CUB 817 928 3.09e-25 SMART
CUB 932 1042 1.29e-36 SMART
CUB 1048 1161 3.46e-37 SMART
CUB 1165 1277 7.24e-40 SMART
CUB 1278 1389 8.33e-31 SMART
CUB 1391 1506 3.08e-43 SMART
CUB 1510 1619 1.9e-34 SMART
CUB 1620 1734 7.24e-40 SMART
CUB 1738 1850 6.02e-37 SMART
CUB 1852 1963 1.57e-26 SMART
CUB 1978 2091 3.46e-28 SMART
CUB 2092 2213 2.88e-34 SMART
CUB 2217 2334 4.13e-35 SMART
CUB 2336 2448 3.1e-39 SMART
CUB 2452 2565 5.37e-34 SMART
CUB 2570 2687 3e-23 SMART
CUB 2689 2801 3.1e-39 SMART
CUB 2805 2919 2.36e-21 SMART
CUB 2920 3035 6.18e-25 SMART
CUB 3037 3150 5.16e-36 SMART
CUB 3157 3274 1.68e-35 SMART
CUB 3278 3393 7.17e-12 SMART
CUB 3395 3507 2.49e-29 SMART
CUB 3511 3623 2.4e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149137
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.3%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,154,556 (GRCm39) probably benign Het
Anapc2 A G 2: 25,174,595 (GRCm39) K653E possibly damaging Het
Aplp1 T C 7: 30,136,254 (GRCm39) S508G possibly damaging Het
Bend3 T A 10: 43,387,722 (GRCm39) V705D probably damaging Het
Btaf1 C A 19: 36,968,175 (GRCm39) A1120E possibly damaging Het
Carmil3 T C 14: 55,731,081 (GRCm39) V116A probably damaging Het
Cdk5rap3 A T 11: 96,802,459 (GRCm39) Y238* probably null Het
Cep170 T C 1: 176,597,076 (GRCm39) H427R probably benign Het
Edc4 G T 8: 106,615,886 (GRCm39) E694* probably null Het
Entrep1 T A 19: 23,952,958 (GRCm39) T451S probably benign Het
Epb41l4b A G 4: 57,086,003 (GRCm39) S191P probably damaging Het
Fbxo46 T C 7: 18,870,727 (GRCm39) Y449H probably damaging Het
Ficd C A 5: 113,876,986 (GRCm39) P387Q probably damaging Het
Grin2b T C 6: 135,710,721 (GRCm39) T942A probably benign Het
Hoxb1 G C 11: 96,257,754 (GRCm39) R228P probably damaging Het
Jmjd1c T C 10: 67,085,541 (GRCm39) F2444L probably damaging Het
Kcnj2 T C 11: 110,962,917 (GRCm39) F103S probably damaging Het
Mapkbp1 A G 2: 119,845,836 (GRCm39) I402V probably benign Het
Mtcl2 T A 2: 156,862,262 (GRCm39) S1556C probably damaging Het
Mvp A G 7: 126,595,095 (GRCm39) V250A probably benign Het
Myo1b T A 1: 51,836,582 (GRCm39) N293I probably damaging Het
Npy5r T A 8: 67,133,512 (GRCm39) Y427F probably benign Het
Nrdc C T 4: 108,904,806 (GRCm39) T747M probably damaging Het
Nrxn2 C T 19: 6,548,397 (GRCm39) P30L possibly damaging Het
Nt5dc3 T C 10: 86,656,857 (GRCm39) F332S probably damaging Het
Optc T G 1: 133,832,828 (GRCm39) T91P probably benign Het
Or14j10 A G 17: 37,934,698 (GRCm39) I276T possibly damaging Het
Or8b12c A G 9: 37,716,103 (GRCm39) T299A probably benign Het
Otud7b A T 3: 96,048,799 (GRCm39) E92V probably damaging Het
Pgap4 A G 4: 49,586,226 (GRCm39) L314P probably benign Het
Pla2g4d A G 2: 120,100,036 (GRCm39) I677T probably benign Het
Pot1a T C 6: 25,778,893 (GRCm39) E67G probably damaging Het
Ppil6 T C 10: 41,383,494 (GRCm39) S257P probably damaging Het
Ppp1r14a T C 7: 28,988,791 (GRCm39) L11P probably benign Het
Ppp1r14bl A T 1: 23,141,071 (GRCm39) I81N probably damaging Het
Pramel13 A T 4: 144,119,232 (GRCm39) M445K probably benign Het
Rad21l A T 2: 151,499,430 (GRCm39) I257K probably benign Het
Rbm11 A G 16: 75,389,861 (GRCm39) D9G possibly damaging Het
Rhbdf2 T C 11: 116,491,488 (GRCm39) Y586C probably damaging Het
Rxfp2 A T 5: 149,980,275 (GRCm39) I276F probably damaging Het
Sec14l4 A G 11: 3,996,342 (GRCm39) *404W probably null Het
Sec16a A G 2: 26,329,264 (GRCm39) V917A probably benign Het
Sec61a2 A T 2: 5,887,461 (GRCm39) Y131* probably null Het
Sspo A T 6: 48,442,517 (GRCm39) Y2004F probably damaging Het
Stab2 T C 10: 86,783,026 (GRCm39) E674G probably benign Het
Tmf1 A G 6: 97,135,048 (GRCm39) S989P probably damaging Het
Tshz1 T C 18: 84,031,393 (GRCm39) D1005G probably damaging Het
Wdr19 T C 5: 65,385,562 (GRCm39) S555P probably benign Het
Zdhhc24 T A 19: 4,933,591 (GRCm39) probably null Het
Zfp558 A G 9: 18,367,669 (GRCm39) M373T probably benign Het
Other mutations in Cubn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cubn APN 2 13,496,631 (GRCm39) unclassified probably benign
IGL00228:Cubn APN 2 13,461,508 (GRCm39) missense probably damaging 1.00
IGL00231:Cubn APN 2 13,386,660 (GRCm39) missense possibly damaging 0.89
IGL00327:Cubn APN 2 13,431,867 (GRCm39) missense possibly damaging 0.73
IGL00470:Cubn APN 2 13,283,229 (GRCm39) missense probably benign 0.00
IGL00519:Cubn APN 2 13,287,730 (GRCm39) missense probably benign 0.00
IGL00562:Cubn APN 2 13,299,041 (GRCm39) missense probably benign 0.01
IGL00678:Cubn APN 2 13,472,521 (GRCm39) missense possibly damaging 0.47
IGL00834:Cubn APN 2 13,386,738 (GRCm39) missense probably damaging 1.00
IGL00946:Cubn APN 2 13,461,434 (GRCm39) missense probably damaging 0.98
IGL00971:Cubn APN 2 13,283,219 (GRCm39) missense possibly damaging 0.77
IGL01124:Cubn APN 2 13,482,904 (GRCm39) missense possibly damaging 0.62
IGL01287:Cubn APN 2 13,315,377 (GRCm39) missense probably damaging 1.00
IGL01410:Cubn APN 2 13,470,719 (GRCm39) missense probably benign 0.31
IGL01418:Cubn APN 2 13,288,852 (GRCm39) missense probably benign 0.01
IGL01450:Cubn APN 2 13,355,673 (GRCm39) splice site probably benign
IGL01534:Cubn APN 2 13,470,744 (GRCm39) nonsense probably null
IGL01584:Cubn APN 2 13,313,472 (GRCm39) splice site probably benign
IGL01595:Cubn APN 2 13,330,027 (GRCm39) missense probably benign 0.05
IGL01625:Cubn APN 2 13,311,085 (GRCm39) missense possibly damaging 0.76
IGL01732:Cubn APN 2 13,494,747 (GRCm39) nonsense probably null
IGL01972:Cubn APN 2 13,450,883 (GRCm39) missense possibly damaging 0.90
IGL02027:Cubn APN 2 13,292,405 (GRCm39) missense probably damaging 1.00
IGL02033:Cubn APN 2 13,344,657 (GRCm39) missense probably damaging 0.98
IGL02124:Cubn APN 2 13,386,648 (GRCm39) missense probably damaging 0.99
IGL02335:Cubn APN 2 13,432,645 (GRCm39) splice site probably null
IGL02491:Cubn APN 2 13,326,039 (GRCm39) missense probably damaging 1.00
IGL02686:Cubn APN 2 13,330,037 (GRCm39) missense possibly damaging 0.92
IGL02707:Cubn APN 2 13,450,843 (GRCm39) missense probably damaging 0.99
IGL02746:Cubn APN 2 13,449,851 (GRCm39) missense probably damaging 1.00
IGL02873:Cubn APN 2 13,299,181 (GRCm39) missense probably benign 0.07
IGL02897:Cubn APN 2 13,323,123 (GRCm39) missense possibly damaging 0.55
IGL03078:Cubn APN 2 13,291,905 (GRCm39) missense possibly damaging 0.87
IGL03245:Cubn APN 2 13,360,500 (GRCm39) missense probably benign 0.09
IGL03289:Cubn APN 2 13,431,778 (GRCm39) missense probably benign 0.00
IGL03335:Cubn APN 2 13,365,140 (GRCm39) missense probably damaging 1.00
IGL03355:Cubn APN 2 13,482,868 (GRCm39) splice site probably null
mellow UTSW 2 13,482,889 (GRCm39) missense probably damaging 1.00
PIT4354001:Cubn UTSW 2 13,473,663 (GRCm39) nonsense probably null
PIT4495001:Cubn UTSW 2 13,496,561 (GRCm39) missense probably benign 0.00
R0145:Cubn UTSW 2 13,311,243 (GRCm39) missense probably damaging 1.00
R0220:Cubn UTSW 2 13,361,520 (GRCm39) missense probably damaging 1.00
R0254:Cubn UTSW 2 13,480,846 (GRCm39) critical splice donor site probably null
R0254:Cubn UTSW 2 13,445,325 (GRCm39) missense possibly damaging 0.84
R0254:Cubn UTSW 2 13,429,505 (GRCm39) missense probably benign 0.01
R0360:Cubn UTSW 2 13,315,318 (GRCm39) splice site probably benign
R0364:Cubn UTSW 2 13,315,318 (GRCm39) splice site probably benign
R0383:Cubn UTSW 2 13,435,770 (GRCm39) missense probably damaging 1.00
R0419:Cubn UTSW 2 13,474,575 (GRCm39) missense possibly damaging 0.87
R0419:Cubn UTSW 2 13,474,574 (GRCm39) missense possibly damaging 0.77
R0498:Cubn UTSW 2 13,449,078 (GRCm39) missense probably damaging 0.99
R0560:Cubn UTSW 2 13,433,491 (GRCm39) missense probably damaging 1.00
R0615:Cubn UTSW 2 13,365,063 (GRCm39) splice site probably null
R0735:Cubn UTSW 2 13,496,500 (GRCm39) splice site probably benign
R0780:Cubn UTSW 2 13,461,424 (GRCm39) missense probably damaging 1.00
R0899:Cubn UTSW 2 13,367,139 (GRCm39) missense possibly damaging 0.54
R1118:Cubn UTSW 2 13,341,053 (GRCm39) missense possibly damaging 0.78
R1182:Cubn UTSW 2 13,449,811 (GRCm39) missense probably damaging 0.98
R1439:Cubn UTSW 2 13,292,379 (GRCm39) missense probably damaging 0.96
R1450:Cubn UTSW 2 13,365,130 (GRCm39) missense probably damaging 1.00
R1464:Cubn UTSW 2 13,330,099 (GRCm39) missense possibly damaging 0.87
R1464:Cubn UTSW 2 13,330,099 (GRCm39) missense possibly damaging 0.87
R1476:Cubn UTSW 2 13,480,931 (GRCm39) missense probably benign 0.04
R1508:Cubn UTSW 2 13,431,916 (GRCm39) missense probably benign 0.25
R1532:Cubn UTSW 2 13,292,472 (GRCm39) missense probably damaging 1.00
R1562:Cubn UTSW 2 13,432,778 (GRCm39) missense probably damaging 1.00
R1598:Cubn UTSW 2 13,474,600 (GRCm39) missense probably benign 0.00
R1761:Cubn UTSW 2 13,494,128 (GRCm39) critical splice donor site probably null
R1862:Cubn UTSW 2 13,313,372 (GRCm39) missense probably damaging 1.00
R1874:Cubn UTSW 2 13,327,813 (GRCm39) missense probably damaging 1.00
R1923:Cubn UTSW 2 13,315,337 (GRCm39) missense probably damaging 1.00
R1944:Cubn UTSW 2 13,283,349 (GRCm39) missense probably benign 0.01
R1960:Cubn UTSW 2 13,344,828 (GRCm39) splice site probably null
R2021:Cubn UTSW 2 13,313,360 (GRCm39) missense probably benign 0.09
R2137:Cubn UTSW 2 13,340,978 (GRCm39) missense probably benign 0.01
R2138:Cubn UTSW 2 13,449,189 (GRCm39) missense probably damaging 0.99
R2139:Cubn UTSW 2 13,340,978 (GRCm39) missense probably benign 0.01
R2179:Cubn UTSW 2 13,323,053 (GRCm39) missense possibly damaging 0.85
R2328:Cubn UTSW 2 13,408,891 (GRCm39) nonsense probably null
R2369:Cubn UTSW 2 13,496,028 (GRCm39) missense probably damaging 1.00
R2428:Cubn UTSW 2 13,480,961 (GRCm39) missense probably damaging 1.00
R2435:Cubn UTSW 2 13,323,083 (GRCm39) missense probably damaging 1.00
R2567:Cubn UTSW 2 13,283,167 (GRCm39) splice site probably null
R2850:Cubn UTSW 2 13,327,764 (GRCm39) missense probably damaging 1.00
R2853:Cubn UTSW 2 13,435,645 (GRCm39) missense probably benign 0.00
R2893:Cubn UTSW 2 13,362,950 (GRCm39) missense possibly damaging 0.61
R3107:Cubn UTSW 2 13,367,158 (GRCm39) missense possibly damaging 0.73
R3109:Cubn UTSW 2 13,367,158 (GRCm39) missense possibly damaging 0.73
R3119:Cubn UTSW 2 13,362,973 (GRCm39) missense possibly damaging 0.90
R3405:Cubn UTSW 2 13,338,319 (GRCm39) missense probably benign 0.00
R3703:Cubn UTSW 2 13,355,754 (GRCm39) missense probably damaging 1.00
R3704:Cubn UTSW 2 13,355,754 (GRCm39) missense probably damaging 1.00
R3705:Cubn UTSW 2 13,355,754 (GRCm39) missense probably damaging 1.00
R3764:Cubn UTSW 2 13,336,396 (GRCm39) missense possibly damaging 0.79
R3792:Cubn UTSW 2 13,432,725 (GRCm39) missense probably damaging 1.00
R3802:Cubn UTSW 2 13,365,164 (GRCm39) missense probably benign 0.01
R3813:Cubn UTSW 2 13,299,136 (GRCm39) missense probably damaging 1.00
R3845:Cubn UTSW 2 13,287,819 (GRCm39) missense probably damaging 1.00
R3846:Cubn UTSW 2 13,287,819 (GRCm39) missense probably damaging 1.00
R3900:Cubn UTSW 2 13,291,791 (GRCm39) critical splice donor site probably null
R3921:Cubn UTSW 2 13,331,488 (GRCm39) missense probably damaging 1.00
R4075:Cubn UTSW 2 13,318,810 (GRCm39) missense possibly damaging 0.58
R4082:Cubn UTSW 2 13,433,374 (GRCm39) intron probably benign
R4405:Cubn UTSW 2 13,470,841 (GRCm39) missense probably damaging 1.00
R4615:Cubn UTSW 2 13,433,560 (GRCm39) missense probably damaging 1.00
R4629:Cubn UTSW 2 13,318,790 (GRCm39) splice site probably null
R4770:Cubn UTSW 2 13,319,578 (GRCm39) missense possibly damaging 0.92
R4799:Cubn UTSW 2 13,355,869 (GRCm39) missense probably damaging 1.00
R4799:Cubn UTSW 2 13,291,835 (GRCm39) missense possibly damaging 0.94
R4812:Cubn UTSW 2 13,463,887 (GRCm39) missense probably damaging 1.00
R4825:Cubn UTSW 2 13,330,036 (GRCm39) missense probably damaging 1.00
R4934:Cubn UTSW 2 13,494,721 (GRCm39) missense probably benign 0.06
R4967:Cubn UTSW 2 13,352,856 (GRCm39) missense probably benign 0.01
R5187:Cubn UTSW 2 13,292,379 (GRCm39) missense probably damaging 0.96
R5232:Cubn UTSW 2 13,483,013 (GRCm39) nonsense probably null
R5305:Cubn UTSW 2 13,393,750 (GRCm39) missense probably damaging 1.00
R5506:Cubn UTSW 2 13,496,506 (GRCm39) splice site probably null
R5531:Cubn UTSW 2 13,355,743 (GRCm39) missense probably benign 0.00
R5737:Cubn UTSW 2 13,393,702 (GRCm39) missense probably damaging 1.00
R5886:Cubn UTSW 2 13,324,834 (GRCm39) splice site probably benign
R5923:Cubn UTSW 2 13,490,889 (GRCm39) missense possibly damaging 0.73
R6032:Cubn UTSW 2 13,329,995 (GRCm39) missense probably benign 0.12
R6032:Cubn UTSW 2 13,329,995 (GRCm39) missense probably benign 0.12
R6084:Cubn UTSW 2 13,435,708 (GRCm39) missense probably damaging 1.00
R6087:Cubn UTSW 2 13,432,658 (GRCm39) missense probably damaging 1.00
R6133:Cubn UTSW 2 13,313,429 (GRCm39) missense probably benign 0.29
R6181:Cubn UTSW 2 13,354,687 (GRCm39) missense probably benign 0.31
R6301:Cubn UTSW 2 13,482,889 (GRCm39) missense probably damaging 1.00
R6320:Cubn UTSW 2 13,285,006 (GRCm39) missense probably damaging 1.00
R6368:Cubn UTSW 2 13,480,934 (GRCm39) missense probably damaging 0.98
R6368:Cubn UTSW 2 13,435,806 (GRCm39) missense probably damaging 0.96
R6383:Cubn UTSW 2 13,432,646 (GRCm39) critical splice donor site probably null
R6393:Cubn UTSW 2 13,360,491 (GRCm39) missense probably benign 0.08
R6408:Cubn UTSW 2 13,299,014 (GRCm39) missense probably damaging 1.00
R6470:Cubn UTSW 2 13,327,804 (GRCm39) missense possibly damaging 0.87
R6532:Cubn UTSW 2 13,463,813 (GRCm39) missense probably benign 0.01
R6599:Cubn UTSW 2 13,315,484 (GRCm39) missense possibly damaging 0.95
R6629:Cubn UTSW 2 13,435,683 (GRCm39) missense probably damaging 1.00
R6641:Cubn UTSW 2 13,480,875 (GRCm39) missense probably damaging 1.00
R6800:Cubn UTSW 2 13,326,066 (GRCm39) missense probably damaging 1.00
R6823:Cubn UTSW 2 13,449,840 (GRCm39) missense probably benign 0.21
R6847:Cubn UTSW 2 13,449,064 (GRCm39) critical splice donor site probably null
R6885:Cubn UTSW 2 13,323,089 (GRCm39) missense probably damaging 1.00
R6962:Cubn UTSW 2 13,352,840 (GRCm39) missense probably benign 0.03
R6973:Cubn UTSW 2 13,386,648 (GRCm39) missense possibly damaging 0.61
R6975:Cubn UTSW 2 13,491,600 (GRCm39) missense probably damaging 0.99
R7076:Cubn UTSW 2 13,311,092 (GRCm39) missense probably benign 0.10
R7076:Cubn UTSW 2 13,311,091 (GRCm39) missense probably benign 0.00
R7086:Cubn UTSW 2 13,324,669 (GRCm39) missense probably damaging 0.98
R7162:Cubn UTSW 2 13,347,309 (GRCm39) missense probably damaging 0.96
R7203:Cubn UTSW 2 13,355,814 (GRCm39) missense probably benign 0.01
R7292:Cubn UTSW 2 13,429,550 (GRCm39) missense probably damaging 0.99
R7307:Cubn UTSW 2 13,345,143 (GRCm39) missense probably damaging 0.99
R7329:Cubn UTSW 2 13,473,582 (GRCm39) missense probably damaging 0.99
R7395:Cubn UTSW 2 13,291,875 (GRCm39) missense probably damaging 1.00
R7417:Cubn UTSW 2 13,431,778 (GRCm39) missense probably benign 0.00
R7429:Cubn UTSW 2 13,327,804 (GRCm39) missense possibly damaging 0.87
R7430:Cubn UTSW 2 13,327,804 (GRCm39) missense possibly damaging 0.87
R7443:Cubn UTSW 2 13,460,320 (GRCm39) missense probably damaging 1.00
R7699:Cubn UTSW 2 13,494,728 (GRCm39) missense possibly damaging 0.74
R7699:Cubn UTSW 2 13,352,989 (GRCm39) missense probably benign
R7700:Cubn UTSW 2 13,494,728 (GRCm39) missense possibly damaging 0.74
R7700:Cubn UTSW 2 13,352,989 (GRCm39) missense probably benign
R7751:Cubn UTSW 2 13,365,176 (GRCm39) missense probably damaging 1.00
R7755:Cubn UTSW 2 13,284,889 (GRCm39) missense probably benign 0.11
R7759:Cubn UTSW 2 13,352,961 (GRCm39) missense probably damaging 1.00
R7903:Cubn UTSW 2 13,473,680 (GRCm39) missense probably damaging 0.97
R7921:Cubn UTSW 2 13,429,538 (GRCm39) missense probably benign 0.22
R7988:Cubn UTSW 2 13,337,166 (GRCm39) missense probably benign 0.43
R8010:Cubn UTSW 2 13,340,897 (GRCm39) critical splice donor site probably null
R8020:Cubn UTSW 2 13,483,989 (GRCm39) missense probably benign 0.01
R8120:Cubn UTSW 2 13,336,471 (GRCm39) missense probably damaging 1.00
R8133:Cubn UTSW 2 13,393,659 (GRCm39) missense probably damaging 1.00
R8185:Cubn UTSW 2 13,299,129 (GRCm39) missense probably benign 0.11
R8224:Cubn UTSW 2 13,354,688 (GRCm39) missense probably benign 0.16
R8289:Cubn UTSW 2 13,491,613 (GRCm39) missense probably benign 0.10
R8326:Cubn UTSW 2 13,311,274 (GRCm39) missense probably benign 0.01
R8331:Cubn UTSW 2 13,345,053 (GRCm39) missense probably damaging 1.00
R8338:Cubn UTSW 2 13,435,658 (GRCm39) missense probably benign 0.08
R8341:Cubn UTSW 2 13,433,535 (GRCm39) missense probably damaging 1.00
R8358:Cubn UTSW 2 13,329,971 (GRCm39) missense probably benign 0.17
R8427:Cubn UTSW 2 13,433,567 (GRCm39) missense probably benign 0.00
R8432:Cubn UTSW 2 13,386,610 (GRCm39) missense probably benign 0.00
R8441:Cubn UTSW 2 13,432,658 (GRCm39) missense probably damaging 1.00
R8442:Cubn UTSW 2 13,318,855 (GRCm39) missense probably damaging 1.00
R8520:Cubn UTSW 2 13,313,331 (GRCm39) critical splice donor site probably null
R8699:Cubn UTSW 2 13,388,770 (GRCm39) missense probably damaging 1.00
R8753:Cubn UTSW 2 13,313,377 (GRCm39) nonsense probably null
R8874:Cubn UTSW 2 13,365,157 (GRCm39) missense possibly damaging 0.63
R9056:Cubn UTSW 2 13,461,466 (GRCm39) missense probably damaging 1.00
R9079:Cubn UTSW 2 13,291,914 (GRCm39) missense probably benign 0.02
R9143:Cubn UTSW 2 13,337,276 (GRCm39) splice site probably benign
R9261:Cubn UTSW 2 13,283,262 (GRCm39) missense probably damaging 1.00
R9338:Cubn UTSW 2 13,386,703 (GRCm39) missense probably damaging 1.00
R9342:Cubn UTSW 2 13,463,767 (GRCm39) missense probably damaging 0.99
R9603:Cubn UTSW 2 13,292,510 (GRCm39) missense probably damaging 1.00
R9614:Cubn UTSW 2 13,482,945 (GRCm39) missense probably benign 0.00
R9615:Cubn UTSW 2 13,325,991 (GRCm39) missense possibly damaging 0.88
R9616:Cubn UTSW 2 13,319,529 (GRCm39) missense probably benign 0.04
R9774:Cubn UTSW 2 13,433,530 (GRCm39) missense probably benign
X0018:Cubn UTSW 2 13,463,797 (GRCm39) missense probably damaging 1.00
X0022:Cubn UTSW 2 13,480,887 (GRCm39) missense probably damaging 1.00
X0026:Cubn UTSW 2 13,347,392 (GRCm39) missense probably damaging 1.00
X0063:Cubn UTSW 2 13,327,773 (GRCm39) missense probably damaging 1.00
YA93:Cubn UTSW 2 13,388,803 (GRCm39) missense probably benign 0.21
Z1088:Cubn UTSW 2 13,299,040 (GRCm39) missense probably benign 0.43
Z1176:Cubn UTSW 2 13,386,636 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAAGGACTGTTTTAACTGGTGAAG -3'
(R):5'- TGTTGTGAGTAATAAGCACCCTC -3'

Sequencing Primer
(F):5'- ACTGGTGAAGCTTCTATTTTCAC -3'
(R):5'- TGTGAGTAATAAGCACCCTCTGTACC -3'
Posted On 2017-12-01