Incidental Mutation 'R5477:Zfp715'
ID501105
Institutional Source Beutler Lab
Gene Symbol Zfp715
Ensembl Gene ENSMUSG00000012640
Gene Namezinc finger protein 715
Synonymsmszf15, 2610041B18Rik
MMRRC Submission 043038-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5477 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location43296197-43313294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43299954 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 194 (Y194C)
Ref Sequence ENSEMBL: ENSMUSP00000114600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012796] [ENSMUST00000048015] [ENSMUST00000107986] [ENSMUST00000135130] [ENSMUST00000139061] [ENSMUST00000145622]
Predicted Effect probably benign
Transcript: ENSMUST00000012796
SMART Domains Protein: ENSMUSP00000012796
Gene: ENSMUSG00000012640

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 124 146 3.39e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000048015
AA Change: Y194C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040282
Gene: ENSMUSG00000012640
AA Change: Y194C

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 356 378 1.28e-3 SMART
ZnF_C2H2 384 406 1.03e-2 SMART
ZnF_C2H2 412 434 4.79e-3 SMART
ZnF_C2H2 440 462 1.45e-2 SMART
ZnF_C2H2 468 490 1.12e-3 SMART
ZnF_C2H2 496 518 2.57e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 1.92e-2 SMART
ZnF_C2H2 580 602 9.58e-3 SMART
ZnF_C2H2 608 630 8.6e-5 SMART
ZnF_C2H2 636 658 1.13e-4 SMART
ZnF_C2H2 691 713 1.98e-4 SMART
ZnF_C2H2 719 741 8.34e-3 SMART
ZnF_C2H2 747 769 3.95e-4 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 825 3.39e-3 SMART
ZnF_C2H2 831 853 1.95e-3 SMART
ZnF_C2H2 859 881 2.09e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107986
AA Change: Y194C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103620
Gene: ENSMUSG00000012640
AA Change: Y194C

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 356 378 1.28e-3 SMART
ZnF_C2H2 384 406 1.03e-2 SMART
ZnF_C2H2 412 434 4.79e-3 SMART
ZnF_C2H2 440 462 1.45e-2 SMART
ZnF_C2H2 468 490 1.12e-3 SMART
ZnF_C2H2 496 518 2.57e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 1.92e-2 SMART
ZnF_C2H2 580 602 9.58e-3 SMART
ZnF_C2H2 608 630 8.6e-5 SMART
ZnF_C2H2 636 658 1.13e-4 SMART
ZnF_C2H2 691 713 1.98e-4 SMART
ZnF_C2H2 719 741 8.34e-3 SMART
ZnF_C2H2 747 769 3.95e-4 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 825 3.39e-3 SMART
ZnF_C2H2 831 853 1.95e-3 SMART
ZnF_C2H2 859 881 2.09e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135130
SMART Domains Protein: ENSMUSP00000122812
Gene: ENSMUSG00000012640

DomainStartEndE-ValueType
KRAB 48 88 5.49e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139061
AA Change: Y194C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114600
Gene: ENSMUSG00000012640
AA Change: Y194C

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151659
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9930021J03Rik A G 19: 29,754,118 V498A probably benign Het
Aacs T C 5: 125,511,920 Y421H probably damaging Het
Abca13 A G 11: 9,301,298 K2890R possibly damaging Het
Aff4 T A 11: 53,408,472 probably null Het
Cntn4 A T 6: 106,673,950 Q698L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dmrt1 A G 19: 25,509,800 M157V probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Gm10521 T A 1: 171,896,500 M126K unknown Het
Hs2st1 A G 3: 144,556,948 probably benign Het
Lats2 T C 14: 57,699,553 D113G probably benign Het
Myo15 A C 11: 60,477,677 D421A probably damaging Het
Olfr1347 T C 7: 6,488,571 Y94C probably benign Het
Olfr178 T A 16: 58,889,744 I159F probably benign Het
Olfr181 A T 16: 58,926,030 D180E possibly damaging Het
Pappa2 T A 1: 158,956,738 D234V probably benign Het
Parl G T 16: 20,280,074 T311K possibly damaging Het
Pias3 G A 3: 96,705,003 R557H probably damaging Het
Pskh1 C T 8: 105,929,879 R396C probably damaging Het
Rc3h2 T C 2: 37,399,630 D390G possibly damaging Het
Ryr2 G T 13: 11,705,656 P2702Q probably damaging Het
Senp6 C A 9: 80,143,843 A961D probably damaging Het
Slc27a3 A G 3: 90,386,839 S503P probably benign Het
Slc39a12 T C 2: 14,389,382 V21A possibly damaging Het
Sox7 A G 14: 63,948,496 Y327C probably damaging Het
Spdl1 A T 11: 34,822,210 F288I possibly damaging Het
Ssbp2 T A 13: 91,664,125 M127K probably damaging Het
Sspo A C 6: 48,498,393 S5032R possibly damaging Het
Sycp1 A T 3: 102,818,890 W973R probably damaging Het
Tm4sf5 C T 11: 70,510,348 T130I probably benign Het
Top2a T A 11: 99,016,480 K175* probably null Het
Trim30d T A 7: 104,472,140 Y316F probably damaging Het
Vmn1r124 G A 7: 21,259,728 P297L probably damaging Het
Other mutations in Zfp715
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Zfp715 APN 7 43299749 missense possibly damaging 0.53
IGL00984:Zfp715 APN 7 43299784 missense probably benign 0.28
IGL03401:Zfp715 APN 7 43299736 missense probably benign 0.18
R0373:Zfp715 UTSW 7 43299336 missense possibly damaging 0.96
R1167:Zfp715 UTSW 7 43298437 missense possibly damaging 0.83
R1943:Zfp715 UTSW 7 43299630 missense possibly damaging 0.86
R1987:Zfp715 UTSW 7 43298649 missense possibly damaging 0.71
R2073:Zfp715 UTSW 7 43311120 missense probably benign 0.01
R2116:Zfp715 UTSW 7 43297946 missense possibly damaging 0.71
R2403:Zfp715 UTSW 7 43299268 missense possibly damaging 0.91
R3707:Zfp715 UTSW 7 43311129 missense probably benign
R3838:Zfp715 UTSW 7 43299756 missense probably benign 0.33
R4059:Zfp715 UTSW 7 43301731 missense probably benign 0.11
R4110:Zfp715 UTSW 7 43297880 missense possibly damaging 0.72
R4426:Zfp715 UTSW 7 43311092 missense probably damaging 0.99
R4675:Zfp715 UTSW 7 43300020 missense probably benign 0.15
R4898:Zfp715 UTSW 7 43299682 missense possibly damaging 0.48
R5007:Zfp715 UTSW 7 43299595 missense possibly damaging 0.53
R5574:Zfp715 UTSW 7 43311039 missense possibly damaging 0.94
R5594:Zfp715 UTSW 7 43299692 missense possibly damaging 0.73
R5967:Zfp715 UTSW 7 43299148 missense probably benign 0.04
R6538:Zfp715 UTSW 7 43299149 missense possibly damaging 0.73
R7322:Zfp715 UTSW 7 43311138 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TGAGAACATCTCCATTCCCAG -3'
(R):5'- GTTTATAGCAATGTGGCAAGTGAAG -3'

Sequencing Primer
(F):5'- ACAGTTAGCATTACAGGAGCC -3'
(R):5'- GTGACAAGAGATGGTTCATGGTG -3'
Posted On2017-12-01