Incidental Mutation 'R5496:Mnd1'
ID501129
Institutional Source Beutler Lab
Gene Symbol Mnd1
Ensembl Gene ENSMUSG00000033752
Gene Namemeiotic nuclear divisions 1
Synonyms2610034E18Rik
MMRRC Submission 043057-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5496 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location84087933-84155786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84088174 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 171 (D171V)
Ref Sequence ENSEMBL: ENSMUSP00000048262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047368]
Predicted Effect probably damaging
Transcript: ENSMUST00000047368
AA Change: D171V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048262
Gene: ENSMUSG00000033752
AA Change: D171V

DomainStartEndE-ValueType
Pfam:Penicillinase_R 10 129 6.9e-8 PFAM
Pfam:Mnd1 16 202 1.7e-76 PFAM
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of the MND1 gene associates with HOP2 (MIM 608665) to form a stable heterodimeric complex that binds DNA and stimulates the recombinase activity of RAD51 (MIM 179617) and DMC1 (MIM 602721) (Chi et al., 2007 [PubMed 17639080]). Both the MND1 and HOP2 genes are indispensable for meiotic recombination.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutants for this allele display defects in homologous chromosome synapsis and double-strand break repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G A 5: 8,674,818 V84I probably benign Het
Adam10 T G 9: 70,722,739 F151C probably damaging Het
Akap6 A G 12: 53,140,653 S1617G possibly damaging Het
Ano6 T A 15: 95,967,614 probably null Het
Atmin A G 8: 116,957,172 T524A probably benign Het
Bicra C T 7: 15,987,841 V584I probably benign Het
Carmil1 G A 13: 24,155,450 R54C probably damaging Het
Cbln1 A G 8: 87,471,696 I127T possibly damaging Het
Ccl26 A G 5: 135,563,363 V40A probably benign Het
Cdh7 T A 1: 110,048,917 I104N probably damaging Het
Cdt1 C T 8: 122,570,500 R311W probably damaging Het
Col12a1 A G 9: 79,602,185 probably benign Het
Csf2rb A G 15: 78,340,561 E173G probably damaging Het
Cyb561 A G 11: 105,937,719 Y94H probably damaging Het
Cyp3a16 T A 5: 145,467,531 K34M probably damaging Het
Diras2 C T 13: 52,507,750 V174M probably benign Het
Dnah7a T G 1: 53,457,768 M3110L probably benign Het
Dyrk2 T C 10: 118,860,051 E434G probably damaging Het
Ebag9 T G 15: 44,640,420 *214E probably null Het
Egln3 A T 12: 54,203,324 W80R probably damaging Het
Eps15l1 A G 8: 72,382,775 Y336H probably benign Het
Gak A G 5: 108,576,617 S1076P probably benign Het
Glra1 T C 11: 55,527,415 Y168C probably damaging Het
Glrx2 T A 1: 143,745,207 M108K probably damaging Het
Gm3604 A T 13: 62,371,579 S59T possibly damaging Het
Gm8212 A T 14: 44,201,157 probably benign Het
Gmcl1 G T 6: 86,697,525 A457D probably damaging Het
H2-M11 T C 17: 36,547,979 F137S possibly damaging Het
Ighv1-55 C G 12: 115,208,520 W3S probably damaging Het
Il22 T G 10: 118,205,097 V36G possibly damaging Het
Ints1 G A 5: 139,755,198 A1904V probably benign Het
Iqgap2 A G 13: 95,630,053 Y1481H probably damaging Het
Kcnn3 C T 3: 89,609,490 A402V possibly damaging Het
Kif18b A T 11: 102,913,742 I362N possibly damaging Het
Kif5c C G 2: 49,730,190 A223G possibly damaging Het
Kntc1 A G 5: 123,784,182 D948G probably benign Het
Krba1 A G 6: 48,406,356 T229A possibly damaging Het
Leprot T A 4: 101,657,896 I113N probably damaging Het
Lrp1b T C 2: 40,927,973 D2415G probably benign Het
Maats1 A G 16: 38,321,493 I359T probably damaging Het
Mthfsd A T 8: 121,098,814 Y339* probably null Het
Nfatc2 G A 2: 168,536,278 T268M probably damaging Het
Olfr1097 G T 2: 86,890,314 P287Q probably damaging Het
Olfr1097 G C 2: 86,890,315 P287A probably damaging Het
Olfr116 T C 17: 37,624,578 D19G probably benign Het
Olfr653 G C 7: 104,580,494 A283P probably damaging Het
Pan3 G A 5: 147,527,128 probably null Het
Pde6a A T 18: 61,253,665 probably null Het
Prss39 T C 1: 34,500,261 I194T possibly damaging Het
Rfx8 T C 1: 39,670,347 S507G probably benign Het
Rif1 T C 2: 52,098,916 S774P probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Smurf1 C A 5: 144,882,593 E601* probably null Het
Stau2 T C 1: 16,390,021 S231G probably damaging Het
Timp2 T G 11: 118,303,881 M161L probably benign Het
Tlr5 T C 1: 182,973,632 L167P probably damaging Het
Trhr G A 15: 44,197,536 A151T probably benign Het
Unc13d A G 11: 116,066,708 V807A probably damaging Het
Usp2 T C 9: 44,085,208 V7A possibly damaging Het
Uspl1 A G 5: 149,209,779 T447A probably damaging Het
Zan A G 5: 137,436,345 I2232T unknown Het
Zfp12 C A 5: 143,244,795 C292* probably null Het
Zfp850 A C 7: 28,007,346 M43R probably damaging Het
Zic5 G A 14: 122,459,343 T620M unknown Het
Other mutations in Mnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Mnd1 APN 3 84138198 missense possibly damaging 0.95
IGL01355:Mnd1 APN 3 84116477 missense probably benign 0.00
IGL02413:Mnd1 APN 3 84116479 missense probably benign
IGL03303:Mnd1 APN 3 84104937 missense probably benign 0.00
trinidad UTSW 3 84134109 missense probably benign 0.30
R0569:Mnd1 UTSW 3 84104979 missense probably benign 0.36
R1564:Mnd1 UTSW 3 84116431 missense probably benign 0.41
R2208:Mnd1 UTSW 3 84134109 missense probably benign 0.30
R2211:Mnd1 UTSW 3 84134109 missense probably benign 0.30
R2964:Mnd1 UTSW 3 84134109 missense probably benign 0.30
R2965:Mnd1 UTSW 3 84134109 missense probably benign 0.30
R3106:Mnd1 UTSW 3 84134109 missense probably benign 0.30
R6319:Mnd1 UTSW 3 84141764 missense possibly damaging 0.95
X0026:Mnd1 UTSW 3 84093558 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTTAATGAGTACTGTGGGATAC -3'
(R):5'- AATTGCTGAGGGAACGAGCC -3'

Sequencing Primer
(F):5'- GCTTCAAAACGGTAAACAATTAGCAG -3'
(R):5'- AACGAGCCCGGCCTCAG -3'
Posted On2017-12-01