Incidental Mutation 'R5536:Drosha'
ID501139
Institutional Source Beutler Lab
Gene Symbol Drosha
Ensembl Gene ENSMUSG00000022191
Gene Namedrosha, ribonuclease type III
Synonyms1110013A17Rik, Rnasen, Etohi2
MMRRC Submission 043094-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R5536 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location12824815-12935291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12929711 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 1331 (Y1331N)
Ref Sequence ENSEMBL: ENSMUSP00000129279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090292] [ENSMUST00000169061]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090292
AA Change: Y1331N

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000087762
Gene: ENSMUSG00000022191
AA Change: Y1331N

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
low complexity region 43 69 N/A INTRINSIC
low complexity region 72 102 N/A INTRINSIC
low complexity region 109 137 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 227 269 N/A INTRINSIC
low complexity region 273 301 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
low complexity region 387 410 N/A INTRINSIC
low complexity region 472 499 N/A INTRINSIC
SCOP:d1jfza_ 878 902 4e-4 SMART
RIBOc 942 1076 1.73e-45 SMART
Blast:RIBOc 1086 1112 1e-6 BLAST
RIBOc 1121 1253 1.6e-49 SMART
DSRM 1260 1332 5.75e-20 SMART
coiled coil region 1346 1370 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000121499
Gene: ENSMUSG00000022191
AA Change: Y973N

DomainStartEndE-ValueType
low complexity region 115 142 N/A INTRINSIC
SCOP:d1jfza_ 521 545 6e-4 SMART
RIBOc 585 719 1.73e-45 SMART
Blast:RIBOc 729 755 1e-6 BLAST
RIBOc 764 896 1.6e-49 SMART
DSRM 903 975 5.75e-20 SMART
coiled coil region 988 1012 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169061
AA Change: Y1331N

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129279
Gene: ENSMUSG00000022191
AA Change: Y1331N

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
low complexity region 43 69 N/A INTRINSIC
low complexity region 72 102 N/A INTRINSIC
low complexity region 109 137 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 227 269 N/A INTRINSIC
low complexity region 273 301 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
low complexity region 387 410 N/A INTRINSIC
low complexity region 472 499 N/A INTRINSIC
SCOP:d1jfza_ 878 902 4e-4 SMART
RIBOc 942 1076 1.73e-45 SMART
Blast:RIBOc 1086 1112 1e-6 BLAST
RIBOc 1121 1253 1.6e-49 SMART
DSRM 1260 1332 5.75e-20 SMART
coiled coil region 1346 1370 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ribonuclease (RNase) III double-stranded RNA-specific ribonuclease and subunit of the microprocessor protein complex, which catalyzes the initial processing step of microRNA (miRNA) synthesis. The encoded protein cleaves the stem loop structure from the primary microRNA (pri-miRNA) in the nucleus, yielding the precursor miRNA (pre-miRNA), which is then exported to the cytoplasm for further processing. In a human cell line lacking a functional copy of this gene, canonical miRNA synthesis is reduced. Somatic mutations in this gene have been observed in human patients with kidney cancer. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice heterozygous for a knock-out allele and a conditional allele activated in the immune system exhibit increased inflammation in multiple systems, cachexia and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,066,388 G446V possibly damaging Het
Aadac T G 3: 60,039,563 N227K probably benign Het
Acap1 C T 11: 69,889,307 G74R probably benign Het
Adrm1 A G 2: 180,172,188 probably benign Het
Appl1 G C 14: 26,923,780 S691* probably null Het
Atp2a2 T C 5: 122,457,182 D1035G probably benign Het
AW551984 A G 9: 39,592,873 I599T probably benign Het
Col23a1 C A 11: 51,567,949 D304E probably damaging Het
Csmd1 T C 8: 16,288,660 R478G probably damaging Het
Dnah7a T C 1: 53,425,253 N3660D probably benign Het
E2f6 T G 12: 16,824,684 S256A probably benign Het
Evc A G 5: 37,326,583 probably benign Het
Fsip2 A T 2: 82,987,059 I4379F probably benign Het
Galnt2 T C 8: 124,323,673 C91R probably damaging Het
Gm3095 G T 14: 3,964,502 M73I probably benign Het
Gpr179 T A 11: 97,343,815 Q480L probably damaging Het
Gucy2g T A 19: 55,237,927 I186F probably benign Het
Hmcn1 T A 1: 150,755,291 I919F probably benign Het
Kdm3a A C 6: 71,611,936 V363G probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lama5 C T 2: 180,189,349 R1839H probably damaging Het
Lpo T C 11: 87,816,563 D208G probably damaging Het
Lpp A G 16: 24,845,206 D411G possibly damaging Het
Marco T C 1: 120,504,735 S8G possibly damaging Het
Mthfr T C 4: 148,044,483 F171S probably damaging Het
Nlrx1 A T 9: 44,263,886 S198T probably damaging Het
Nol10 C A 12: 17,416,137 S511* probably null Het
Nup153 T C 13: 46,683,009 T1375A probably benign Het
Obscn A G 11: 59,107,871 S1367P probably damaging Het
Olfr1269 A G 2: 90,118,839 V253A probably benign Het
Pcdha7 G A 18: 36,975,250 V443M probably damaging Het
Plekha1 G T 7: 130,909,601 R305I probably damaging Het
Psmb2 T A 4: 126,684,209 I60N probably damaging Het
Rad17 C A 13: 100,631,104 G330C probably damaging Het
Slc5a6 A G 5: 31,043,102 S80P probably damaging Het
Srgap2 T A 1: 131,300,390 probably null Het
Taf8 C A 17: 47,494,482 R164L possibly damaging Het
Tmem87a C A 2: 120,397,430 D79Y probably damaging Het
Tmtc4 G A 14: 122,932,879 R574W probably benign Het
Tprn G A 2: 25,263,357 A224T probably benign Het
Usf3 A G 16: 44,217,370 T738A probably benign Het
Vmn2r54 A C 7: 12,632,416 V197G probably benign Het
Zbtb40 G T 4: 136,987,331 P1049Q probably damaging Het
Zfp551 A T 7: 12,415,561 S640R possibly damaging Het
Zfp932 T A 5: 110,009,847 C470* probably null Het
Zkscan8 T C 13: 21,526,668 I91V probably damaging Het
Zmat4 T C 8: 23,748,492 V30A probably damaging Het
Other mutations in Drosha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Drosha APN 15 12883194 missense probably damaging 0.99
IGL00736:Drosha APN 15 12833959 missense unknown
IGL00963:Drosha APN 15 12925997 missense probably damaging 0.99
IGL01010:Drosha APN 15 12827289 unclassified probably benign
IGL01340:Drosha APN 15 12834023 intron probably benign
IGL01481:Drosha APN 15 12842439 missense probably benign
IGL01714:Drosha APN 15 12878784 missense probably damaging 1.00
IGL01721:Drosha APN 15 12846112 nonsense probably null
IGL01765:Drosha APN 15 12902680 missense probably damaging 1.00
IGL01893:Drosha APN 15 12866650 splice site probably benign
IGL01944:Drosha APN 15 12889719 missense probably damaging 1.00
IGL02285:Drosha APN 15 12833864 missense unknown
IGL02970:Drosha APN 15 12913956 missense probably damaging 0.98
IGL02990:Drosha APN 15 12827267 unclassified probably benign
IGL03019:Drosha APN 15 12846099 missense probably damaging 1.00
IGL03279:Drosha APN 15 12859392 missense probably benign 0.03
IGL03390:Drosha APN 15 12884983 splice site probably null
tippicanoe UTSW 15 12859465 splice site probably null
Tyler UTSW 15 12861706 missense probably benign 0.45
R0115:Drosha UTSW 15 12846130 missense probably benign 0.15
R0352:Drosha UTSW 15 12837288 missense unknown
R0401:Drosha UTSW 15 12926031 nonsense probably null
R0541:Drosha UTSW 15 12907388 missense probably benign 0.09
R0784:Drosha UTSW 15 12867678 splice site probably benign
R0918:Drosha UTSW 15 12842533 critical splice donor site probably null
R1473:Drosha UTSW 15 12912520 missense probably benign 0.04
R1503:Drosha UTSW 15 12848073 missense probably benign 0.02
R1526:Drosha UTSW 15 12913984 missense probably damaging 1.00
R1809:Drosha UTSW 15 12890112 missense probably null 1.00
R1859:Drosha UTSW 15 12878718 missense probably benign 0.14
R2004:Drosha UTSW 15 12915381 missense probably damaging 0.98
R2060:Drosha UTSW 15 12924159 missense possibly damaging 0.94
R2516:Drosha UTSW 15 12859465 splice site probably null
R3691:Drosha UTSW 15 12834638 missense unknown
R3784:Drosha UTSW 15 12890529 missense possibly damaging 0.82
R3789:Drosha UTSW 15 12912537 nonsense probably null
R3790:Drosha UTSW 15 12912537 nonsense probably null
R4020:Drosha UTSW 15 12837336 missense possibly damaging 0.96
R4817:Drosha UTSW 15 12914047 missense probably damaging 0.97
R4989:Drosha UTSW 15 12935007 missense probably benign 0.05
R5080:Drosha UTSW 15 12842143 missense probably benign 0.01
R5132:Drosha UTSW 15 12837291 missense unknown
R5215:Drosha UTSW 15 12885133 intron probably benign
R5386:Drosha UTSW 15 12842121 missense probably benign
R5457:Drosha UTSW 15 12926029 missense probably benign 0.26
R5800:Drosha UTSW 15 12865067 missense probably damaging 1.00
R5800:Drosha UTSW 15 12902647 missense probably damaging 1.00
R5915:Drosha UTSW 15 12935066 missense probably damaging 0.97
R5988:Drosha UTSW 15 12834496 intron probably benign
R6033:Drosha UTSW 15 12925999 missense probably benign 0.25
R6033:Drosha UTSW 15 12925999 missense probably benign 0.25
R6063:Drosha UTSW 15 12834070 intron probably benign
R6391:Drosha UTSW 15 12889717 nonsense probably null
R6492:Drosha UTSW 15 12861706 missense probably benign 0.45
R6799:Drosha UTSW 15 12912537 nonsense probably null
R6870:Drosha UTSW 15 12907393 missense probably benign 0.17
R6920:Drosha UTSW 15 12834310 missense unknown
R7101:Drosha UTSW 15 12865067 missense probably damaging 1.00
R7142:Drosha UTSW 15 12924146 missense possibly damaging 0.70
R7275:Drosha UTSW 15 12846083 missense possibly damaging 0.73
R7337:Drosha UTSW 15 12846199 missense possibly damaging 0.80
R7471:Drosha UTSW 15 12889656 missense probably damaging 1.00
R7538:Drosha UTSW 15 12926243 missense probably damaging 1.00
R7559:Drosha UTSW 15 12842422 missense probably damaging 0.96
R7653:Drosha UTSW 15 12859436 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TTCCTAGCCGTGCAATTTGGTG -3'
(R):5'- AAACAGAAGGCTGCTCCCAG -3'

Sequencing Primer
(F):5'- CAATTTGGTGTGTGATGGAAGTAATC -3'
(R):5'- CAGGACTGCCTTCGGAAAC -3'
Posted On2017-12-01