Incidental Mutation 'R0130:Fyn'
ID50114
Institutional Source Beutler Lab
Gene Symbol Fyn
Ensembl Gene ENSMUSG00000019843
Gene NameFyn proto-oncogene
SynonymsSrc Kinase p59
MMRRC Submission 038415-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0130 (G1)
Quality Score155
Status Validated (trace)
Chromosome10
Chromosomal Location39368855-39565381 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39511982 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 78 (T78M)
Ref Sequence ENSEMBL: ENSMUSP00000123445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063091] [ENSMUST00000099967] [ENSMUST00000126486] [ENSMUST00000135242] [ENSMUST00000136659] [ENSMUST00000146287] [ENSMUST00000148152] [ENSMUST00000157009]
Predicted Effect probably benign
Transcript: ENSMUST00000063091
AA Change: T78M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000057707
Gene: ENSMUSG00000019843
AA Change: T78M

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 3.86e-34 SMART
TyrKc 268 517 8.07e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099967
AA Change: T78M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097547
Gene: ENSMUSG00000019843
AA Change: T78M

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 1.65e-33 SMART
TyrKc 271 520 1.08e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126486
AA Change: T78M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115233
Gene: ENSMUSG00000019843
AA Change: T78M

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 3.86e-34 SMART
TyrKc 268 517 8.07e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135242
AA Change: T78M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117111
Gene: ENSMUSG00000019843
AA Change: T78M

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 3.86e-34 SMART
TyrKc 268 517 8.07e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136659
AA Change: T78M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118131
Gene: ENSMUSG00000019843
AA Change: T78M

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 4.37e-33 SMART
TyrKc 222 465 7.5e-119 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146287
AA Change: T78M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000114188
Gene: ENSMUSG00000019843
AA Change: T78M

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 3.86e-34 SMART
TyrKc 268 517 8.07e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148152
AA Change: T78M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000123445
Gene: ENSMUSG00000019843
AA Change: T78M

DomainStartEndE-ValueType
low complexity region 73 86 N/A INTRINSIC
Pfam:SH3_1 88 114 8.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000157009
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.7%
  • 10x: 93.4%
  • 20x: 80.2%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protein-tyrosine kinase oncogene family. It encodes a membrane-associated tyrosine kinase that has been implicated in the control of cell growth. The protein associates with the p85 subunit of phosphatidylinositol 3-kinase and interacts with the fyn-binding protein. Alternatively spliced transcript variants encoding distinct isoforms exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Different targeted allele homozygotes show different defects, including seizure susceptibility, anxiety, impaired suckling, myelination, LTP and spatial learning, and defects in immune system, circadian rhythm, testes weight and olfactory bulb formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A T 17: 84,686,666 Y37F probably damaging Het
Ablim2 G A 5: 35,809,176 probably benign Het
Anxa9 A G 3: 95,302,422 S129P probably benign Het
Apol7c A G 15: 77,526,362 I128T possibly damaging Het
Arfgef2 T G 2: 166,835,719 I88S probably damaging Het
Arfip2 A G 7: 105,638,998 probably benign Het
Atp5j2 A T 5: 145,188,182 probably benign Het
Atp7b C T 8: 22,028,172 E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 probably null Het
Cd22 A G 7: 30,869,964 Y402H possibly damaging Het
Cd248 A G 19: 5,069,962 T613A probably benign Het
Cdcp2 C T 4: 107,106,707 probably benign Het
Cenpc1 A T 5: 86,046,546 D120E probably benign Het
Chd3 T A 11: 69,359,830 H691L probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cped1 T A 6: 22,121,039 Y373N probably benign Het
Cr2 A T 1: 195,166,231 V328D probably damaging Het
Ctnnd2 A T 15: 30,921,913 E895V probably damaging Het
D630045J12Rik A T 6: 38,149,771 probably benign Het
Dcdc2a A T 13: 25,187,672 probably benign Het
Dync1h1 C A 12: 110,618,674 T837K probably benign Het
Eif2ak3 C A 6: 70,881,732 probably benign Het
Epb41l5 A C 1: 119,549,902 V705G possibly damaging Het
Fat2 T A 11: 55,252,118 M4302L probably benign Het
Flnb T C 14: 7,901,951 V938A probably damaging Het
Frmd4a T C 2: 4,604,092 Y928H probably damaging Het
Gdap2 A G 3: 100,201,995 T443A probably damaging Het
Gde1 A T 7: 118,695,060 F63L probably benign Het
Gjc3 A G 5: 137,957,940 S28P probably benign Het
Gm10250 G A 15: 5,120,991 probably null Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Klhl23 T C 2: 69,833,966 V553A probably damaging Het
Lman2l G T 1: 36,424,864 S171* probably null Het
Lrp1b T C 2: 41,511,508 D378G probably damaging Het
Map3k11 T C 19: 5,690,815 L190P probably damaging Het
Mki67 T A 7: 135,696,459 Q2282L probably damaging Het
Mthfd2 T A 6: 83,309,008 I272F probably damaging Het
Myom1 A T 17: 71,045,755 D358V probably damaging Het
Nebl T A 2: 17,393,023 Q487H possibly damaging Het
Nebl T C 2: 17,390,926 probably benign Het
Nlrp2 T A 7: 5,322,418 N14Y possibly damaging Het
Olfr1090 T C 2: 86,753,887 M284V probably benign Het
Olfr304 T C 7: 86,386,306 Y118C probably damaging Het
Olfr339 T A 2: 36,422,287 D296E probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr992 T A 2: 85,399,961 S191C probably damaging Het
Paxip1 C T 5: 27,744,185 probably benign Het
Pclo A G 5: 14,679,797 probably benign Het
Pld2 T G 11: 70,554,348 N591K probably benign Het
Plekha7 A G 7: 116,170,704 M276T probably damaging Het
Prss39 T A 1: 34,502,200 probably benign Het
Prtg A G 9: 72,809,716 Y113C probably damaging Het
Rab38 T A 7: 88,450,541 I88N probably damaging Het
Rbfox2 A G 15: 77,091,857 probably benign Het
Samd5 A G 10: 9,674,939 W9R probably damaging Het
Sec14l1 A T 11: 117,156,407 K637I possibly damaging Het
Sh2b1 A T 7: 126,471,448 D360E possibly damaging Het
Sh3bp4 A G 1: 89,145,314 N628S possibly damaging Het
Sim1 A T 10: 50,907,961 I104F probably damaging Het
Smcp T A 3: 92,584,520 T7S unknown Het
Sp4 A G 12: 118,300,816 probably benign Het
Tectb G T 19: 55,181,961 K81N probably damaging Het
Thbs4 G T 13: 92,754,410 H850N probably benign Het
Tiam1 T C 16: 89,897,754 M272V probably benign Het
Trav13-3 T A 14: 53,729,776 noncoding transcript Het
Ubap2l A T 3: 90,021,373 S478T possibly damaging Het
Vmn2r85 A G 10: 130,419,185 probably benign Het
Other mutations in Fyn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01988:Fyn APN 10 39533921 nonsense probably null
IGL02626:Fyn APN 10 39526802 missense probably damaging 1.00
H8562:Fyn UTSW 10 39511954 missense probably benign 0.00
R0128:Fyn UTSW 10 39511982 missense probably benign 0.00
R0336:Fyn UTSW 10 39526901 missense possibly damaging 0.52
R1446:Fyn UTSW 10 39522779 missense probably benign 0.43
R1498:Fyn UTSW 10 39532124 missense possibly damaging 0.90
R1539:Fyn UTSW 10 39532070 missense possibly damaging 0.94
R1912:Fyn UTSW 10 39526832 missense possibly damaging 0.94
R2198:Fyn UTSW 10 39529545 missense probably benign 0.13
R2339:Fyn UTSW 10 39522785 missense probably benign 0.00
R3107:Fyn UTSW 10 39551455 missense probably damaging 1.00
R3109:Fyn UTSW 10 39551455 missense probably damaging 1.00
R5068:Fyn UTSW 10 39526843 missense probably damaging 1.00
R5233:Fyn UTSW 10 39529940 missense probably benign
R5929:Fyn UTSW 10 39551461 missense probably damaging 1.00
R6360:Fyn UTSW 10 39526883 missense possibly damaging 0.83
R6379:Fyn UTSW 10 39455074 start gained probably benign
R6490:Fyn UTSW 10 39551402 missense probably damaging 1.00
R7179:Fyn UTSW 10 39532124 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCCGTGTTAGAGCAGCCAGGAAAC -3'
(R):5'- TGCTCCTGAGAAGCCAGGCATTTG -3'

Sequencing Primer
(F):5'- CTTCCATCAGGAGCTTGGATAATG -3'
(R):5'- gtgtgtgtgtgtgtctgtg -3'
Posted On2013-06-12