Incidental Mutation 'R5555:Fer1l4'
ID501149
Institutional Source Beutler Lab
Gene Symbol Fer1l4
Ensembl Gene ENSMUSG00000013338
Gene Namefer-1-like 4 (C. elegans)
Synonyms9130402C12Rik
MMRRC Submission 043112-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5555 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location156019139-156052947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156048189 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 272 (E272G)
Ref Sequence ENSEMBL: ENSMUSP00000105240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109611]
Predicted Effect probably damaging
Transcript: ENSMUST00000109611
AA Change: E272G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338
AA Change: E272G

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,422,296 probably null Het
Atg7 T C 6: 114,702,053 V366A probably damaging Het
Cadm2 A T 16: 66,784,815 V192E probably damaging Het
Chil6 C T 3: 106,389,952 S291N possibly damaging Het
D7Ertd443e T C 7: 134,349,591 T118A probably benign Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah1 T A 14: 31,290,819 T1837S probably damaging Het
Ext1 A G 15: 53,088,143 V515A probably damaging Het
Fras1 T A 5: 96,677,377 H1475Q probably benign Het
Grid1 T C 14: 35,520,705 S672P possibly damaging Het
Gtpbp4 A G 13: 8,979,427 probably null Het
Hsp90aa1 A T 12: 110,692,734 V543E probably damaging Het
Irf5 T C 6: 29,531,146 S4P probably benign Het
Kif2b G T 11: 91,575,460 Q666K probably benign Het
Macc1 A T 12: 119,450,375 H762L probably benign Het
Map1s C T 8: 70,917,107 T941M probably damaging Het
Mrgprb1 T A 7: 48,447,775 I130F probably benign Het
Nbeal1 T G 1: 60,237,152 V684G possibly damaging Het
Ngly1 C T 14: 16,270,508 Q173* probably null Het
Plcb3 A T 19: 6,966,219 M104K probably benign Het
Plcg2 T A 8: 117,612,995 Y1048* probably null Het
Ptprf T C 4: 118,224,924 Y1039C probably damaging Het
Rab38 A G 7: 88,430,487 Y29C probably damaging Het
Rcan2 T A 17: 44,037,030 V210E probably damaging Het
Rptn A T 3: 93,396,701 Q447L probably benign Het
Scel G A 14: 103,602,206 R495K probably benign Het
Scn11a G T 9: 119,755,238 P1437Q probably damaging Het
Sim2 A G 16: 94,109,456 D239G probably damaging Het
Skap2 A G 6: 51,860,018 Y356H probably damaging Het
Skint11 A G 4: 114,194,601 T49A probably benign Het
Snx33 G A 9: 56,925,397 H463Y probably benign Het
Steap2 T C 5: 5,677,544 T264A possibly damaging Het
Stk40 T A 4: 126,135,059 V238E probably damaging Het
Sun2 T C 15: 79,734,127 D277G probably benign Het
Ttll9 T C 2: 152,990,100 probably null Het
Vmn1r54 G A 6: 90,269,365 C87Y probably benign Het
Other mutations in Fer1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fer1l4 APN 2 156019920 nonsense probably null
IGL01025:Fer1l4 APN 2 156052185 missense probably benign 0.41
IGL01103:Fer1l4 APN 2 156044441 critical splice donor site probably null
IGL01322:Fer1l4 APN 2 156020339 splice site probably null
IGL01391:Fer1l4 APN 2 156036456 missense probably damaging 1.00
IGL02176:Fer1l4 APN 2 156048451 missense probably benign
IGL02267:Fer1l4 APN 2 156031252 missense possibly damaging 0.60
IGL02291:Fer1l4 APN 2 156019538 missense probably damaging 1.00
IGL02385:Fer1l4 APN 2 156045428 missense probably benign 0.04
IGL02423:Fer1l4 APN 2 156052907 missense probably benign 0.04
IGL02596:Fer1l4 APN 2 156039132 missense probably benign
IGL02612:Fer1l4 APN 2 156047928 missense probably damaging 1.00
IGL02716:Fer1l4 APN 2 156029715 missense probably damaging 1.00
IGL02738:Fer1l4 APN 2 156045728 missense probably benign
IGL03035:Fer1l4 APN 2 156022606 missense possibly damaging 0.95
IGL03083:Fer1l4 APN 2 156039366 unclassified probably benign
IGL03201:Fer1l4 APN 2 156044730 missense probably benign 0.32
IGL03349:Fer1l4 APN 2 156044734 nonsense probably null
R0033:Fer1l4 UTSW 2 156024106 splice site probably benign
R0356:Fer1l4 UTSW 2 156024010 missense probably damaging 1.00
R0477:Fer1l4 UTSW 2 156052886 missense probably benign 0.43
R0504:Fer1l4 UTSW 2 156052195 missense probably benign 0.36
R0731:Fer1l4 UTSW 2 156024070 missense probably benign 0.17
R0800:Fer1l4 UTSW 2 156045663 missense possibly damaging 0.90
R0884:Fer1l4 UTSW 2 156019313 missense possibly damaging 0.93
R1017:Fer1l4 UTSW 2 156049478 critical splice acceptor site probably null
R1266:Fer1l4 UTSW 2 156046249 missense possibly damaging 0.89
R1544:Fer1l4 UTSW 2 156045633 missense probably benign 0.00
R1657:Fer1l4 UTSW 2 156035598 missense possibly damaging 0.95
R1699:Fer1l4 UTSW 2 156029685 missense probably benign 0.14
R1816:Fer1l4 UTSW 2 156035199 missense probably damaging 0.98
R1950:Fer1l4 UTSW 2 156048274 missense probably damaging 1.00
R2117:Fer1l4 UTSW 2 156039118 missense probably benign 0.00
R2219:Fer1l4 UTSW 2 156031764 missense probably damaging 0.99
R2220:Fer1l4 UTSW 2 156031764 missense probably damaging 0.99
R2879:Fer1l4 UTSW 2 156052200 missense probably damaging 1.00
R3746:Fer1l4 UTSW 2 156035048 missense probably benign 0.01
R3806:Fer1l4 UTSW 2 156045683 missense probably damaging 1.00
R3807:Fer1l4 UTSW 2 156045683 missense probably damaging 1.00
R4224:Fer1l4 UTSW 2 156020389 missense probably benign 0.37
R4274:Fer1l4 UTSW 2 156020544 missense probably damaging 1.00
R4569:Fer1l4 UTSW 2 156036639 missense possibly damaging 0.77
R4619:Fer1l4 UTSW 2 156047087 missense probably damaging 1.00
R4707:Fer1l4 UTSW 2 156045623 missense possibly damaging 0.69
R4914:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4915:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4917:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4918:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4941:Fer1l4 UTSW 2 156045089 missense probably damaging 1.00
R5011:Fer1l4 UTSW 2 156031215 missense probably damaging 1.00
R5013:Fer1l4 UTSW 2 156031215 missense probably damaging 1.00
R5130:Fer1l4 UTSW 2 156049466 missense possibly damaging 0.54
R5385:Fer1l4 UTSW 2 156037366 nonsense probably null
R5441:Fer1l4 UTSW 2 156023257 missense probably benign 0.00
R5838:Fer1l4 UTSW 2 156051993 missense probably benign 0.01
R6125:Fer1l4 UTSW 2 156046987 missense probably damaging 1.00
R6184:Fer1l4 UTSW 2 156048291 missense probably damaging 1.00
R6246:Fer1l4 UTSW 2 156024982 missense probably damaging 0.99
R6248:Fer1l4 UTSW 2 156046171 missense probably damaging 1.00
R6274:Fer1l4 UTSW 2 156029268 missense probably damaging 1.00
R6298:Fer1l4 UTSW 2 156024740 missense probably damaging 1.00
R6362:Fer1l4 UTSW 2 156048250 missense probably benign 0.08
R6490:Fer1l4 UTSW 2 156047914 missense possibly damaging 0.94
R6494:Fer1l4 UTSW 2 156045470 missense probably benign 0.02
R6516:Fer1l4 UTSW 2 156035199 missense probably damaging 0.98
R6530:Fer1l4 UTSW 2 156047865 critical splice donor site probably null
R6740:Fer1l4 UTSW 2 156031222 missense probably damaging 1.00
R7039:Fer1l4 UTSW 2 156036730 missense probably benign 0.05
R7121:Fer1l4 UTSW 2 156044557 missense probably benign 0.13
R7132:Fer1l4 UTSW 2 156045626 missense probably damaging 0.98
R7382:Fer1l4 UTSW 2 156020749 nonsense probably null
X0063:Fer1l4 UTSW 2 156035011 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCGGTCCCTTTCCTAAAAG -3'
(R):5'- GCCATATTCTAACCCTCGTGG -3'

Sequencing Primer
(F):5'- TAAAAGGCACCTACGTACTCTTTC -3'
(R):5'- TTACCCAGGCAGCTCTGAC -3'
Posted On2017-12-01