Incidental Mutation 'R5567:Adam19'
ID501216
Institutional Source Beutler Lab
Gene Symbol Adam19
Ensembl Gene ENSMUSG00000011256
Gene Namea disintegrin and metallopeptidase domain 19 (meltrin beta)
SynonymsMltnb
MMRRC Submission 043124-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5567 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location46055992-46147343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46136250 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 570 (D570G)
Ref Sequence ENSEMBL: ENSMUSP00000011400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011400]
Predicted Effect probably damaging
Transcript: ENSMUST00000011400
AA Change: D570G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000011400
Gene: ENSMUSG00000011256
AA Change: D570G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 32 163 9.4e-27 PFAM
Pfam:Reprolysin_5 209 388 1.9e-25 PFAM
Pfam:Reprolysin_4 209 399 1.5e-15 PFAM
Pfam:Reprolysin 211 409 1.3e-68 PFAM
Pfam:Reprolysin_2 231 399 6.1e-19 PFAM
Pfam:Reprolysin_3 235 357 1.2e-19 PFAM
DISIN 426 501 9.7e-41 SMART
ACR 502 650 7.46e-62 SMART
transmembrane domain 704 726 N/A INTRINSIC
low complexity region 788 797 N/A INTRINSIC
low complexity region 832 846 N/A INTRINSIC
low complexity region 886 905 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153410
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a cell surface glycoprotein and member of the ADAM (a disintegrin and metalloproteinase) family of endopeptidases. The encoded protein may play a role in the ectodomain shedding of neuregulin proteins. Homozygous knockout mice for this gene exhibit heart development defects and perinatal lethality. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that undergoes proteolytic processing to generate a mature protein product. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice exhibit cardiac developmental defects and die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 C T 6: 86,955,168 Q374* probably null Het
Aqr G A 2: 114,148,970 T328M probably damaging Het
Boc G A 16: 44,492,824 T559I probably damaging Het
Cadps A T 14: 12,473,497 I876N possibly damaging Het
Cdh9 A G 15: 16,855,844 T657A probably damaging Het
Cep104 T C 4: 154,002,277 S794P possibly damaging Het
Cep72 T C 13: 74,040,141 Q211R probably benign Het
Coq6 T A 12: 84,368,639 D145E probably benign Het
Crym T C 7: 120,201,893 E11G probably benign Het
Csmd3 A T 15: 47,645,468 M2907K possibly damaging Het
Cspg4 A C 9: 56,886,648 I556L probably benign Het
Cwf19l2 T A 9: 3,456,831 D721E probably damaging Het
Defb36 T A 2: 152,612,583 V54E probably damaging Het
Dlg5 C A 14: 24,192,913 E55* probably null Het
Dna2 G T 10: 62,966,673 A857S possibly damaging Het
E330034G19Rik A G 14: 24,296,824 K60E possibly damaging Het
Eps8l2 G A 7: 141,355,007 R76Q possibly damaging Het
Fbxl18 A G 5: 142,895,267 probably benign Het
Flnc T A 6: 29,444,045 C619* probably null Het
Ftcd A G 10: 76,588,133 K503E probably benign Het
Gbp2b C T 3: 142,611,365 A494V possibly damaging Het
Gfral C T 9: 76,208,618 A25T probably benign Het
Gins2 T A 8: 120,588,945 D24V possibly damaging Het
Gm10985 T C 3: 53,845,262 I22T probably damaging Het
Gm9992 T C 17: 7,363,803 T456A probably benign Het
Golga4 T A 9: 118,558,183 S1458T probably damaging Het
Gpatch1 T C 7: 35,307,215 K176R probably damaging Het
Gsto1 T C 19: 47,857,899 W62R probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gxylt1 A G 15: 93,254,299 probably null Het
Hs6st1 C T 1: 36,103,638 P218L probably benign Het
Itpr3 C T 17: 27,103,906 T1119M possibly damaging Het
Kif5c A G 2: 49,730,199 D226G possibly damaging Het
Klk1b1 T A 7: 43,971,169 S228T probably damaging Het
Krt1 A G 15: 101,846,905 F473S probably benign Het
Large1 A G 8: 72,837,453 S562P possibly damaging Het
Lpxn T A 19: 12,832,659 M265K possibly damaging Het
Lrriq1 G A 10: 103,170,596 P1223S possibly damaging Het
Map3k9 A G 12: 81,732,024 L505P possibly damaging Het
Morn2 A G 17: 80,297,280 D128G probably damaging Het
Msl2 A G 9: 101,101,737 K437E possibly damaging Het
Msr1 T C 8: 39,611,719 I305V probably benign Het
Muc4 A G 16: 32,777,692 E3237G possibly damaging Het
Mxra8 T C 4: 155,841,008 M58T probably damaging Het
Myo16 A G 8: 10,322,676 D125G probably damaging Het
Myom2 A G 8: 15,102,546 Q631R probably benign Het
Nlrp1b T A 11: 71,181,403 H538L probably benign Het
Nme3 T A 17: 24,896,849 probably null Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Nploc4 C T 11: 120,384,614 V499M probably benign Het
Nub1 A G 5: 24,708,816 E565G possibly damaging Het
Olfr1012 G A 2: 85,759,650 S242F probably damaging Het
Olfr378 C T 11: 73,425,446 C179Y probably damaging Het
Olfr49 A G 14: 54,282,368 F176L probably damaging Het
Olfr859 A G 9: 19,808,378 D20G probably damaging Het
Parl A G 16: 20,283,012 M90T probably damaging Het
Pelo T C 13: 115,089,616 I102V probably benign Het
Pigt T A 2: 164,501,562 Y319* probably null Het
Plb1 A G 5: 32,364,199 T1465A unknown Het
Plxna4 T C 6: 32,157,980 N1763D possibly damaging Het
Pmpca A G 2: 26,390,541 E133G probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Qsox2 A G 2: 26,225,218 M1T probably null Het
Ralb C T 1: 119,483,535 V25I probably damaging Het
Rbbp6 A G 7: 123,001,834 probably benign Het
Rnf43 A G 11: 87,727,445 E187G probably damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Scap A G 9: 110,377,644 S386G probably damaging Het
Skint10 T C 4: 112,715,870 Y243C probably damaging Het
Stpg2 A G 3: 139,419,786 T447A probably benign Het
Tas1r1 G A 4: 152,038,325 A21V probably damaging Het
Tas2r122 C T 6: 132,711,372 G186E probably benign Het
Tenm4 C A 7: 96,896,209 Y2477* probably null Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Tmcc2 A C 1: 132,357,805 S608A probably benign Het
Ttc41 T C 10: 86,760,920 probably null Het
Ttk T A 9: 83,862,535 N593K possibly damaging Het
Tulp1 A G 17: 28,359,198 V289A possibly damaging Het
Uhrf1bp1l T A 10: 89,808,521 M29K probably benign Het
Usp34 A C 11: 23,488,336 Q278P probably damaging Het
Vmn2r78 T A 7: 86,921,529 D418E probably benign Het
Vmn2r90 C T 17: 17,712,074 A81V probably damaging Het
Xpc T A 6: 91,498,135 N636I probably damaging Het
Zfp563 A T 17: 33,089,457 probably benign Het
Other mutations in Adam19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Adam19 APN 11 46112783 missense probably damaging 1.00
IGL01727:Adam19 APN 11 46121553 missense probably benign
IGL01758:Adam19 APN 11 46112924 missense probably benign 0.01
IGL02160:Adam19 APN 11 46139695 missense probably damaging 0.99
IGL02421:Adam19 APN 11 46137553 missense probably damaging 0.96
IGL02572:Adam19 APN 11 46131721 nonsense probably null
IGL02995:Adam19 APN 11 46136349 missense probably benign 0.00
IGL03171:Adam19 APN 11 46138854 missense probably damaging 0.98
IGL03237:Adam19 APN 11 46137556 missense probably benign
R0003:Adam19 UTSW 11 46128789 missense probably damaging 1.00
R0026:Adam19 UTSW 11 46136259 missense probably damaging 1.00
R0158:Adam19 UTSW 11 46143034 missense probably damaging 1.00
R0304:Adam19 UTSW 11 46127392 missense possibly damaging 0.91
R0488:Adam19 UTSW 11 46138930 missense probably damaging 0.98
R0501:Adam19 UTSW 11 46123130 missense probably damaging 1.00
R0591:Adam19 UTSW 11 46121411 splice site probably benign
R0734:Adam19 UTSW 11 46127403 missense probably damaging 0.99
R0747:Adam19 UTSW 11 46118495 splice site probably null
R0771:Adam19 UTSW 11 46121453 missense possibly damaging 0.92
R1052:Adam19 UTSW 11 46127265 missense probably damaging 0.99
R1573:Adam19 UTSW 11 46113618 splice site probably benign
R1735:Adam19 UTSW 11 46138917 missense probably benign 0.26
R1830:Adam19 UTSW 11 46127278 missense probably damaging 0.98
R1911:Adam19 UTSW 11 46121454 missense probably damaging 1.00
R2092:Adam19 UTSW 11 46060904 intron probably null
R3749:Adam19 UTSW 11 46137610 missense probably benign 0.00
R3893:Adam19 UTSW 11 46128838 missense probably damaging 1.00
R3916:Adam19 UTSW 11 46060935 missense probably benign 0.25
R3917:Adam19 UTSW 11 46060935 missense probably benign 0.25
R4506:Adam19 UTSW 11 46118444 missense possibly damaging 0.67
R4767:Adam19 UTSW 11 46138977 critical splice donor site probably null
R5055:Adam19 UTSW 11 46123169 missense probably damaging 1.00
R5313:Adam19 UTSW 11 46131776 missense probably damaging 1.00
R5329:Adam19 UTSW 11 46125026 missense probably damaging 0.99
R5602:Adam19 UTSW 11 46136315 missense probably benign
R6198:Adam19 UTSW 11 46121502 missense probably damaging 1.00
R6875:Adam19 UTSW 11 46112875 missense probably benign
R7011:Adam19 UTSW 11 46143018 missense probably benign 0.00
R7163:Adam19 UTSW 11 46131717 missense probably benign
R7213:Adam19 UTSW 11 46121471 missense probably benign 0.20
R7267:Adam19 UTSW 11 46121576 nonsense probably null
X0067:Adam19 UTSW 11 46056115 start codon destroyed probably null 0.06
Predicted Primers PCR Primer
(F):5'- ATCCTAAGTTGAGCTCTTGGC -3'
(R):5'- TTGGTTCCAGTCATCACCAG -3'

Sequencing Primer
(F):5'- TCTGCTGAGACACAAGGAACCTG -3'
(R):5'- TCCAGTCATCACCAGCCCTG -3'
Posted On2017-12-01