Incidental Mutation 'R5616:Prkca'
ID501223
Institutional Source Beutler Lab
Gene Symbol Prkca
Ensembl Gene ENSMUSG00000050965
Gene Nameprotein kinase C, alpha
SynonymsPkca
MMRRC Submission 043159-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R5616 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location107933387-108343928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107978343 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 472 (D472G)
Ref Sequence ENSEMBL: ENSMUSP00000062392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059595] [ENSMUST00000100302]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059595
AA Change: D472G

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062392
Gene: ENSMUSG00000050965
AA Change: D472G

DomainStartEndE-ValueType
C1 37 86 3.09e-16 SMART
C1 102 151 1.33e-15 SMART
C2 172 275 7.66e-26 SMART
S_TKc 339 597 8.85e-98 SMART
S_TK_X 598 660 1.58e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100302
AA Change: D48G

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097875
Gene: ENSMUSG00000050965
AA Change: D48G

DomainStartEndE-ValueType
Pfam:Pkinase 2 173 9.3e-44 PFAM
Pfam:Pkinase_Tyr 3 159 3.7e-25 PFAM
S_TK_X 174 236 1.58e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134910
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show no overt macroscopic abnormalities, however examination of one line revealed increased cardiac muscle contractility and protection against heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 A T 3: 121,772,360 D443E probably benign Het
Arhgef5 A G 6: 43,275,940 D1037G probably benign Het
B3glct T A 5: 149,729,934 L148* probably null Het
Cacna1e G A 1: 154,442,194 P1481S probably damaging Het
Cacna1h C A 17: 25,377,667 R117L probably damaging Het
Cct6b A T 11: 82,741,349 V271E probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Cul1 G A 6: 47,523,788 R707H probably damaging Het
Dcakd A G 11: 102,995,005 L191P possibly damaging Het
Dhx32 T C 7: 133,721,228 *612W probably null Het
Disp1 T A 1: 183,088,349 T836S probably benign Het
Dppa4 T A 16: 48,291,030 V126D probably damaging Het
Fam98b A G 2: 117,267,786 T246A possibly damaging Het
Fkbp4 A T 6: 128,433,554 V273E probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr31b A G 17: 13,051,944 Y113H probably damaging Het
Gpr33 T C 12: 52,023,594 I221V probably damaging Het
Klhl1 A G 14: 96,518,293 F9L probably benign Het
Larp4b T A 13: 9,158,659 N449K probably damaging Het
Loxhd1 T C 18: 77,404,951 S1363P probably damaging Het
Lrrc8a T C 2: 30,255,354 V60A probably benign Het
Matn3 A G 12: 8,948,195 H51R probably benign Het
Mtrf1 T C 14: 79,401,445 C6R possibly damaging Het
Myh6 T C 14: 54,956,581 S784G probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nipal3 T C 4: 135,452,404 Y401C probably benign Het
Pcdhb20 A G 18: 37,504,532 E37G probably damaging Het
Pelp1 G A 11: 70,394,862 P727S possibly damaging Het
Ptprg A G 14: 12,122,120 H328R probably benign Het
Rtl1 C T 12: 109,592,739 E889K unknown Het
Rubcn T C 16: 32,826,923 D715G possibly damaging Het
Snurf C T 7: 59,999,385 E15K possibly damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Srp72 T G 5: 76,987,934 L237R probably damaging Het
Syne3 T C 12: 104,955,678 E406G probably damaging Het
Tgm2 A G 2: 158,128,720 S340P probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 probably benign Het
Tsc22d1 T C 14: 76,416,217 probably benign Het
Tsc22d2 G T 3: 58,417,162 probably benign Het
Vmn1r42 T C 6: 89,845,102 I162V possibly damaging Het
Vmn2r59 A G 7: 42,058,767 probably null Het
Wnt3 T C 11: 103,812,770 probably null Het
Other mutations in Prkca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Prkca APN 11 108343508 missense probably benign 0.10
IGL00903:Prkca APN 11 107983974 missense probably damaging 1.00
IGL01385:Prkca APN 11 107978352 missense probably damaging 1.00
IGL01396:Prkca APN 11 108014322 missense possibly damaging 0.59
IGL01480:Prkca APN 11 108192201 missense probably damaging 1.00
IGL01480:Prkca APN 11 107986289 missense possibly damaging 0.93
IGL01516:Prkca APN 11 107961602 missense probably null 1.00
IGL01553:Prkca APN 11 108057834 missense probably benign 0.15
IGL02975:Prkca APN 11 108340677 nonsense probably null
IGL03402:Prkca APN 11 108340663 missense probably benign 0.20
R0101:Prkca UTSW 11 108057800 missense probably damaging 1.00
R0279:Prkca UTSW 11 108054111 splice site probably benign
R0454:Prkca UTSW 11 107978280 missense probably benign
R0513:Prkca UTSW 11 108014376 missense possibly damaging 0.82
R0711:Prkca UTSW 11 107981654 missense probably benign 0.16
R0894:Prkca UTSW 11 108012692 missense possibly damaging 0.66
R0966:Prkca UTSW 11 108014284 missense possibly damaging 0.56
R1432:Prkca UTSW 11 107939520 missense probably benign 0.27
R1518:Prkca UTSW 11 107978316 missense probably damaging 1.00
R1667:Prkca UTSW 11 107983946 missense probably damaging 1.00
R1795:Prkca UTSW 11 108012692 missense possibly damaging 0.66
R1909:Prkca UTSW 11 107939612 missense possibly damaging 0.68
R1932:Prkca UTSW 11 108192149 missense probably benign 0.13
R2509:Prkca UTSW 11 107979206 missense probably damaging 1.00
R3889:Prkca UTSW 11 107979240 missense probably damaging 1.00
R4018:Prkca UTSW 11 107939602 missense probably damaging 1.00
R4684:Prkca UTSW 11 107961608 missense probably damaging 0.99
R5132:Prkca UTSW 11 108192117 splice site probably benign
R5298:Prkca UTSW 11 108012684 missense probably damaging 0.98
R5546:Prkca UTSW 11 108053980 missense probably benign 0.14
R5558:Prkca UTSW 11 107981647 missense probably damaging 1.00
R5626:Prkca UTSW 11 108057815 missense possibly damaging 0.94
R5931:Prkca UTSW 11 108014310 missense probably benign 0.01
R6061:Prkca UTSW 11 108057845 missense probably benign 0.03
R7125:Prkca UTSW 11 107984022 missense probably damaging 1.00
R7283:Prkca UTSW 11 108340645 critical splice donor site probably null
R7329:Prkca UTSW 11 108014277 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TTGACACAGCGATCGTGACC -3'
(R):5'- ATATCCCAGGGTCTCCATCG -3'

Sequencing Primer
(F):5'- TGACCCACACATGACCTTG -3'
(R):5'- GAAAGACATGGTACTTCCTTGGCC -3'
Posted On2017-12-01