Incidental Mutation 'R5668:Nup188'
ID501237
Institutional Source Beutler Lab
Gene Symbol Nup188
Ensembl Gene ENSMUSG00000052533
Gene Namenucleoporin 188
Synonyms
MMRRC Submission 043311-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R5668 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location30286397-30344266 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30336324 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 1118 (A1118T)
Ref Sequence ENSEMBL: ENSMUSP00000065836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064447]
Predicted Effect probably damaging
Transcript: ENSMUST00000064447
AA Change: A1118T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065836
Gene: ENSMUSG00000052533
AA Change: A1118T

DomainStartEndE-ValueType
Pfam:Nup188 31 941 9.3e-213 PFAM
low complexity region 1020 1035 N/A INTRINSIC
low complexity region 1307 1320 N/A INTRINSIC
low complexity region 1330 1360 N/A INTRINSIC
low complexity region 1696 1709 N/A INTRINSIC
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex (NPC) is found on the nuclear envelope and forms a gateway that regulates the flow of proteins and RNAs between the cytoplasm and nucleoplasm. The NPC is comprised of approximately 30 distinct proteins collectively known as nucleoporins. Nucleoporins are pore-complex-specific glycoproteins which often have cytoplasmically oriented O-linked N-acetylglucosamine residues and numerous repeats of the pentapeptide sequence XFXFG. However, the nucleoporin protein encoded by this gene does not contain the typical FG repeat sequences found in most vertebrate nucleoporins. This nucleoporin is thought to form part of the scaffold for the central channel of the nuclear pore. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 A G 7: 28,904,550 W429R probably damaging Het
Afg1l C T 10: 42,360,240 C272Y probably damaging Het
Agrn T C 4: 156,167,313 T1831A probably damaging Het
AI481877 A G 4: 59,047,399 S1407P probably benign Het
Aifm2 T C 10: 61,725,917 V14A probably damaging Het
Angptl3 A T 4: 99,032,084 probably null Het
Arfgap1 A T 2: 180,974,119 D197V possibly damaging Het
Atp1a3 T C 7: 24,978,869 probably benign Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
BC067074 A G 13: 113,317,167 S55G possibly damaging Het
Brwd1 T C 16: 96,016,150 I1387M probably damaging Het
Cavin4 A G 4: 48,672,499 T315A probably benign Het
Cep128 T C 12: 90,999,636 T1066A probably benign Het
Cln3 T C 7: 126,572,386 T376A probably benign Het
Cntn4 A T 6: 106,679,436 silent Het
Colec12 T A 18: 9,848,963 D380E probably damaging Het
Csmd3 T C 15: 47,695,755 I2371V possibly damaging Het
Cxcl3 T C 5: 90,787,440 S99P unknown Het
Ddx60 A G 8: 62,000,578 R1244G probably benign Het
Dhx38 T C 8: 109,553,416 D914G probably damaging Het
Dlc1 T G 8: 36,937,501 probably benign Het
Fam161b A G 12: 84,356,350 S169P probably damaging Het
Fastkd1 A G 2: 69,707,381 S286P possibly damaging Het
Fmn2 A T 1: 174,582,037 E612V unknown Het
Foxb1 T A 9: 69,760,246 M1L probably damaging Het
Gm14412 A T 2: 177,315,609 C164* probably null Het
Gm43302 T A 5: 105,275,812 M432L probably benign Het
Gm4353 C A 7: 116,083,678 A223S probably damaging Het
Gm884 T A 11: 103,617,054 probably benign Het
Gm8994 A T 6: 136,329,395 I264F probably benign Het
Gpatch8 T C 11: 102,500,867 K143R unknown Het
Gpr15 A G 16: 58,717,650 S359P probably damaging Het
Gucy2e A G 11: 69,228,381 L649P probably damaging Het
H2-M10.5 C A 17: 36,774,581 H211N probably damaging Het
Hs6st1 T C 1: 36,103,889 Y302H probably damaging Het
Khdrbs2 A T 1: 32,467,770 D165V probably damaging Het
Klra13-ps T G 6: 130,304,283 noncoding transcript Het
Lrrc37a T A 11: 103,500,175 T1475S probably benign Het
Ly75 A G 2: 60,354,500 S437P probably damaging Het
Maz C T 7: 127,025,322 C342Y probably damaging Het
Mcf2l C A 8: 13,013,812 S1008* probably null Het
Mcmbp T C 7: 128,712,754 D246G probably benign Het
Mipol1 G A 12: 57,325,560 R135H possibly damaging Het
Mycbp2 T A 14: 103,120,519 Y4613F possibly damaging Het
Olfr1226 A T 2: 89,193,826 D69E possibly damaging Het
Olfr1249 G A 2: 89,630,344 L185F probably damaging Het
Olfr1427 A G 19: 12,098,926 S238P probably damaging Het
Olfr267 T A 4: 58,785,489 I78F probably benign Het
Olfr573-ps1 T C 7: 102,941,921 K219E probably benign Het
Olfr585 A T 7: 103,097,896 S52C probably benign Het
Olfr981 A T 9: 40,022,668 I92F probably damaging Het
P3h1 T A 4: 119,244,046 I460N possibly damaging Het
Pcnt T C 10: 76,409,500 D1101G probably benign Het
Phlpp2 C A 8: 109,928,573 Q667K possibly damaging Het
Plec A G 15: 76,190,466 F434L possibly damaging Het
Ppp6r2 T A 15: 89,280,399 I602N probably damaging Het
Rdh8 A C 9: 20,825,179 I181L probably benign Het
Rnf181 A G 6: 72,361,522 M1T probably null Het
Rpl29-ps2 A G 13: 4,614,222 noncoding transcript Het
Sart3 A G 5: 113,745,156 probably null Het
Sec14l2 A C 11: 4,109,189 L160R probably damaging Het
Senp1 C T 15: 98,048,355 R503H probably damaging Het
Slc22a2 T C 17: 12,608,409 V316A probably benign Het
Slc34a1 A T 13: 55,409,085 I365F possibly damaging Het
Spag5 T C 11: 78,304,716 V283A possibly damaging Het
Srebf2 C T 15: 82,192,255 T702I probably benign Het
Sun3 A G 11: 9,031,433 probably null Het
Syt6 A G 3: 103,620,901 Y312C probably damaging Het
Tas2r121 T A 6: 132,700,793 Y72F possibly damaging Het
Tfrc A G 16: 32,623,376 Y473C probably damaging Het
Trp63 C T 16: 25,866,185 A274V possibly damaging Het
Trpm5 T C 7: 143,073,229 D1085G probably benign Het
Ttn A G 2: 76,914,664 V5347A probably benign Het
Vma21-ps T A 4: 52,496,946 Q100L possibly damaging Het
Vmn2r22 T C 6: 123,637,914 N239S probably benign Het
Wfdc8 T C 2: 164,597,419 probably benign Het
Xkr4 T A 1: 3,671,035 Y105F probably damaging Het
Xpo7 C T 14: 70,682,846 V627I possibly damaging Het
Zfp606 T C 7: 12,492,552 V200A probably benign Het
Zfp936 A T 7: 43,190,434 S441C possibly damaging Het
Other mutations in Nup188
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Nup188 APN 2 30333400 missense probably damaging 0.98
IGL01599:Nup188 APN 2 30327525 missense possibly damaging 0.92
IGL01938:Nup188 APN 2 30329359 missense probably benign
IGL01973:Nup188 APN 2 30339850 missense possibly damaging 0.95
IGL02157:Nup188 APN 2 30329373 nonsense probably null
IGL02221:Nup188 APN 2 30330641 missense possibly damaging 0.75
IGL02277:Nup188 APN 2 30326511 missense possibly damaging 0.95
IGL02335:Nup188 APN 2 30323636 critical splice donor site probably null
IGL02986:Nup188 APN 2 30307633 unclassified probably null
IGL03029:Nup188 APN 2 30322580 splice site probably benign
IGL03194:Nup188 APN 2 30304334 missense possibly damaging 0.95
IGL03370:Nup188 APN 2 30340641 missense possibly damaging 0.52
P0027:Nup188 UTSW 2 30322681 missense probably damaging 0.99
R0006:Nup188 UTSW 2 30322023 missense probably benign 0.27
R0360:Nup188 UTSW 2 30326479 missense probably null 0.93
R0373:Nup188 UTSW 2 30330988 missense probably damaging 1.00
R0645:Nup188 UTSW 2 30343466 unclassified probably null
R1411:Nup188 UTSW 2 30343795 missense probably benign 0.01
R1670:Nup188 UTSW 2 30340655 missense probably benign 0.19
R2034:Nup188 UTSW 2 30310085 unclassified probably benign
R2113:Nup188 UTSW 2 30304101 nonsense probably null
R2142:Nup188 UTSW 2 30336706 missense possibly damaging 0.49
R2221:Nup188 UTSW 2 30336924 splice site probably benign
R2567:Nup188 UTSW 2 30341782 missense possibly damaging 0.53
R2964:Nup188 UTSW 2 30325346 missense probably damaging 0.98
R4006:Nup188 UTSW 2 30309878 missense probably damaging 0.99
R4007:Nup188 UTSW 2 30309878 missense probably damaging 0.99
R4079:Nup188 UTSW 2 30309878 missense probably damaging 0.99
R4480:Nup188 UTSW 2 30322129 intron probably benign
R4628:Nup188 UTSW 2 30329346 missense probably damaging 1.00
R4687:Nup188 UTSW 2 30330633 missense probably benign 0.01
R4814:Nup188 UTSW 2 30326511 missense possibly damaging 0.95
R4834:Nup188 UTSW 2 30339584 missense probably damaging 1.00
R5038:Nup188 UTSW 2 30309220 missense probably damaging 0.98
R5056:Nup188 UTSW 2 30304131 missense probably damaging 0.98
R5124:Nup188 UTSW 2 30330935 missense probably damaging 1.00
R5256:Nup188 UTSW 2 30330749 missense probably damaging 1.00
R5284:Nup188 UTSW 2 30330635 missense probably damaging 1.00
R5548:Nup188 UTSW 2 30326493 missense probably damaging 0.99
R5560:Nup188 UTSW 2 30309885 missense probably damaging 0.99
R5769:Nup188 UTSW 2 30330735 missense probably benign 0.34
R5773:Nup188 UTSW 2 30322196 missense possibly damaging 0.92
R5774:Nup188 UTSW 2 30301048 missense probably damaging 1.00
R5827:Nup188 UTSW 2 30339847 missense probably damaging 1.00
R5919:Nup188 UTSW 2 30339894 missense probably damaging 1.00
R5923:Nup188 UTSW 2 30304090 missense probably benign
R6185:Nup188 UTSW 2 30341710 missense probably damaging 0.97
R6457:Nup188 UTSW 2 30322187 missense probably damaging 0.98
R6529:Nup188 UTSW 2 30326454 missense possibly damaging 0.95
R7002:Nup188 UTSW 2 30323568 missense probably damaging 0.99
R7195:Nup188 UTSW 2 30341830 critical splice donor site probably null
R7214:Nup188 UTSW 2 30307554 missense possibly damaging 0.71
R7345:Nup188 UTSW 2 30340601 missense probably benign 0.09
T0722:Nup188 UTSW 2 30322681 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTAGCCACAGCCTGCATAAC -3'
(R):5'- TATCACTGAGCCTCACCTCCAG -3'

Sequencing Primer
(F):5'- GCCTGCATAACAACATGGTG -3'
(R):5'- AGGCCACCTGAGCACTGAC -3'
Posted On2017-12-01