Incidental Mutation 'R5669:Popdc3'
ID501242
Institutional Source Beutler Lab
Gene Symbol Popdc3
Ensembl Gene ENSMUSG00000019848
Gene Namepopeye domain containing 3
SynonymsPop3
MMRRC Submission 043312-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5669 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location45178098-45318452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45316433 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 163 (I163N)
Ref Sequence ENSEMBL: ENSMUSP00000019994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019994] [ENSMUST00000161803] [ENSMUST00000175658]
Predicted Effect probably damaging
Transcript: ENSMUST00000019994
AA Change: I163N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019994
Gene: ENSMUSG00000019848
AA Change: I163N

DomainStartEndE-ValueType
Pfam:Popeye 25 249 1.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161803
SMART Domains Protein: ENSMUSP00000125532
Gene: ENSMUSG00000019848

DomainStartEndE-ValueType
transmembrane domain 27 44 N/A INTRINSIC
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
Pfam:Popeye 107 169 5.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175658
SMART Domains Protein: ENSMUSP00000135373
Gene: ENSMUSG00000019848

DomainStartEndE-ValueType
transmembrane domain 27 44 N/A INTRINSIC
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POP family of proteins containing three putative transmembrane domains. This gene is expressed in cardiac and skeletal muscle and may play an important role in these tissues during development. Alternatively spliced transcript variants have been found. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Akap9 T A 5: 4,050,540 L2734* probably null Het
Aldh1a1 T C 19: 20,610,920 I25T probably damaging Het
Astl G T 2: 127,347,279 R175L probably damaging Het
BC035947 A T 1: 78,497,913 C661S probably damaging Het
Cd160 C T 3: 96,808,898 probably benign Het
Cdc42bpb C T 12: 111,302,013 probably null Het
Cdip1 T A 16: 4,768,815 I149F probably damaging Het
Cfap65 T C 1: 74,924,968 Y607C probably damaging Het
Col6a5 A G 9: 105,925,998 I1256T unknown Het
Copb1 A G 7: 114,237,585 V336A probably damaging Het
Ddx42 A T 11: 106,241,819 D556V probably damaging Het
Dlk1 T C 12: 109,460,038 V279A probably benign Het
Fbll1 T C 11: 35,797,584 N284S probably benign Het
Fbxw21 A T 9: 109,145,510 I314N probably benign Het
Foxa3 T C 7: 19,014,251 T317A probably benign Het
Gm14139 A G 2: 150,192,178 I140V probably benign Het
Gpr37 A T 6: 25,669,352 C498S probably benign Het
Hapln3 G T 7: 79,117,496 probably null Het
Igkv4-54 A G 6: 69,631,848 V29A possibly damaging Het
Itgb8 T A 12: 119,190,628 I225F probably damaging Het
Kcnk3 A G 5: 30,622,349 T248A probably damaging Het
Kcnv1 T C 15: 45,114,252 Q130R possibly damaging Het
Lrp1b T C 2: 41,111,038 H2058R probably damaging Het
Macf1 T A 4: 123,476,225 E1581V probably damaging Het
Mga A G 2: 119,903,426 N252D probably damaging Het
Nadsyn1 C T 7: 143,807,431 G335S probably damaging Het
Olfr1115 T C 2: 87,252,441 V168A probably benign Het
Olfr58 T C 9: 19,783,757 F208S probably benign Het
Pak7 G A 2: 136,116,284 P295S probably damaging Het
Pcsk1 T A 13: 75,130,102 S595T probably benign Het
Pepd T C 7: 35,040,674 V324A probably benign Het
Pml C T 9: 58,247,063 D176N probably benign Het
Ppp1r13l A C 7: 19,373,022 T481P probably benign Het
Pramef12 T C 4: 144,395,843 I44V probably benign Het
Prlh A G 1: 90,953,120 T5A probably benign Het
Prom1 A G 5: 44,012,943 F638S possibly damaging Het
Prpf8 T A 11: 75,504,738 L1897H probably damaging Het
Ret T C 6: 118,184,243 T91A probably benign Het
Retsat A G 6: 72,606,010 S176G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 T C 11: 119,458,785 L3823P possibly damaging Het
Rnf31 C T 14: 55,596,704 A653V probably damaging Het
Rps6kl1 T C 12: 85,147,867 D90G probably damaging Het
Scarb1 A G 5: 125,300,387 Y194H probably damaging Het
Scube2 C T 7: 109,825,439 A556T probably benign Het
Serpinb1a A G 13: 32,845,316 L243P probably damaging Het
Slc39a4 A C 15: 76,614,163 L358R probably damaging Het
Slitrk5 A G 14: 111,681,623 D893G probably damaging Het
Srgap1 C A 10: 121,804,850 V681L probably benign Het
Tmprss6 A T 15: 78,454,956 M262K possibly damaging Het
Ttf2 T A 3: 100,951,117 K719* probably null Het
Vmn1r62 T A 7: 5,675,737 L139* probably null Het
Other mutations in Popdc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Popdc3 APN 10 45317826 unclassified probably null
IGL01304:Popdc3 APN 10 45317909 missense probably benign
IGL01643:Popdc3 APN 10 45314880 missense probably damaging 1.00
IGL02755:Popdc3 APN 10 45315218 missense probably damaging 1.00
R0410:Popdc3 UTSW 10 45317733 missense possibly damaging 0.95
R0586:Popdc3 UTSW 10 45315263 missense probably benign 0.04
R0738:Popdc3 UTSW 10 45315258 missense probably damaging 1.00
R1102:Popdc3 UTSW 10 45316546 unclassified probably benign
R1649:Popdc3 UTSW 10 45315224 missense probably damaging 1.00
R2026:Popdc3 UTSW 10 45314855 missense probably damaging 1.00
R4720:Popdc3 UTSW 10 45314906 missense probably benign 0.04
R5905:Popdc3 UTSW 10 45317919 missense probably benign
R6028:Popdc3 UTSW 10 45317919 missense probably benign
R7468:Popdc3 UTSW 10 45315021 missense probably damaging 1.00
X0057:Popdc3 UTSW 10 45315111 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACAACTTGATGAGCTGTTGGTG -3'
(R):5'- GTATGCTTGCTCGCTTTACAAC -3'

Sequencing Primer
(F):5'- CTACTGTTCCAGACTTCTAGGTGATG -3'
(R):5'- GCTTGCTCGCTTTACAACAAATATTC -3'
Posted On2017-12-01