Incidental Mutation 'R0166:Gm13088'
ID50129
Institutional Source Beutler Lab
Gene Symbol Gm13088
Ensembl Gene ENSMUSG00000078513
Gene Namepredicted gene 13088
Synonyms
MMRRC Submission 038442-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R0166 (G1)
Quality Score143
Status Validated (trace)
Chromosome4
Chromosomal Location143653760-143657246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 143654511 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 314 (H314L)
Ref Sequence ENSEMBL: ENSMUSP00000101397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105771]
Predicted Effect probably benign
Transcript: ENSMUST00000105771
AA Change: H314L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101397
Gene: ENSMUSG00000078513
AA Change: H314L

DomainStartEndE-ValueType
low complexity region 188 202 N/A INTRINSIC
low complexity region 372 391 N/A INTRINSIC
Meta Mutation Damage Score 0.1136 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 91% (49/54)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,853,468 F1040L probably damaging Het
Adamts7 A G 9: 90,193,692 N1201S probably benign Het
Ahnak C T 19: 9,005,725 P1458S probably damaging Het
Akap6 T C 12: 53,140,924 V1707A probably benign Het
Akr1c21 T A 13: 4,581,264 V266E probably damaging Het
Arap2 A C 5: 62,676,018 C894G probably damaging Het
Atp2a2 T C 5: 122,466,838 D426G possibly damaging Het
Azi2 A T 9: 118,055,841 Q132L possibly damaging Het
Carmil1 C T 13: 24,099,049 D91N probably damaging Het
Cnot7 A T 8: 40,507,453 probably null Het
Cntnap5b A G 1: 100,274,361 E311G probably benign Het
Csmd1 A G 8: 16,233,022 V640A probably benign Het
Cst7 T C 2: 150,575,727 S31P probably benign Het
Cyp7b1 T A 3: 18,097,366 I228L probably benign Het
Ddx28 G A 8: 106,010,289 T379I probably benign Het
Dirc2 G A 16: 35,719,314 T379I possibly damaging Het
Drd1 T A 13: 54,053,581 I205F probably damaging Het
Flnb T A 14: 7,896,115 V837D probably damaging Het
Fsd1l A G 4: 53,647,664 probably null Het
Fubp1 T A 3: 152,220,204 Y264* probably null Het
Gbp5 T A 3: 142,506,919 probably null Het
Gm7094 A G 1: 21,272,734 noncoding transcript Het
Gpr55 A G 1: 85,941,136 V241A probably benign Het
Impa1 C T 3: 10,328,960 A16T probably damaging Het
Llgl2 T C 11: 115,844,854 L92P probably damaging Het
Ltbp2 T A 12: 84,786,358 Q1472L probably benign Het
Lyplal1 A T 1: 186,088,746 M168K probably benign Het
Macc1 A T 12: 119,447,080 R528* probably null Het
Mdm1 T A 10: 118,166,680 D635E probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mrpl23 C T 7: 142,535,114 R69W probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nr0b2 A G 4: 133,553,738 Q105R probably damaging Het
Olfr920 T A 9: 38,756,188 S167T probably benign Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Pcdhb14 A T 18: 37,448,489 probably null Het
Plxna1 A G 6: 89,333,019 W1055R probably damaging Het
Prdm1 C T 10: 44,440,091 R716Q probably damaging Het
Proser1 C A 3: 53,480,617 Q909K possibly damaging Het
Pus10 T A 11: 23,667,358 C24S probably damaging Het
Rpl27 T A 11: 101,445,320 F69I possibly damaging Het
Sctr A T 1: 120,055,394 I325F probably damaging Het
Slc5a3 G A 16: 92,077,693 V213I possibly damaging Het
Spib G T 7: 44,529,900 D28E probably damaging Het
Spic T C 10: 88,675,717 S226G possibly damaging Het
Tet1 T A 10: 62,840,279 T673S probably benign Het
Tph1 A G 7: 46,647,596 F392L probably damaging Het
Ttc28 T C 5: 111,225,634 S979P probably benign Het
Unc79 T C 12: 103,156,553 L2110P probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Zfp467 T C 6: 48,438,681 T346A probably benign Het
Other mutations in Gm13088
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Gm13088 APN 4 143655317 missense probably benign 0.00
IGL01418:Gm13088 APN 4 143655317 missense probably benign 0.00
IGL01551:Gm13088 APN 4 143656472 missense probably damaging 0.99
IGL02016:Gm13088 APN 4 143655319 missense possibly damaging 0.52
IGL02157:Gm13088 APN 4 143654377 missense probably damaging 1.00
IGL02433:Gm13088 APN 4 143655437 missense possibly damaging 0.92
IGL02726:Gm13088 APN 4 143655385 missense probably damaging 1.00
IGL02900:Gm13088 APN 4 143655515 missense possibly damaging 0.59
IGL03367:Gm13088 APN 4 143655623 missense possibly damaging 0.46
IGL02835:Gm13088 UTSW 4 143654247 missense probably damaging 1.00
R0141:Gm13088 UTSW 4 143654568 missense probably benign 0.01
R0197:Gm13088 UTSW 4 143656440 missense possibly damaging 0.76
R0365:Gm13088 UTSW 4 143655501 nonsense probably null
R0427:Gm13088 UTSW 4 143654423 missense probably benign 0.00
R0701:Gm13088 UTSW 4 143656440 missense possibly damaging 0.76
R0927:Gm13088 UTSW 4 143654220 missense possibly damaging 0.84
R1103:Gm13088 UTSW 4 143655372 missense probably damaging 1.00
R1163:Gm13088 UTSW 4 143656634 missense probably damaging 1.00
R1565:Gm13088 UTSW 4 143655617 nonsense probably null
R1588:Gm13088 UTSW 4 143655551 missense probably damaging 1.00
R1669:Gm13088 UTSW 4 143654346 missense possibly damaging 0.53
R1925:Gm13088 UTSW 4 143654455 missense probably damaging 1.00
R1929:Gm13088 UTSW 4 143654142 missense probably damaging 1.00
R1990:Gm13088 UTSW 4 143654268 missense probably damaging 1.00
R2272:Gm13088 UTSW 4 143654142 missense probably damaging 1.00
R2845:Gm13088 UTSW 4 143654298 missense probably damaging 0.99
R3819:Gm13088 UTSW 4 143655795 missense probably benign 0.02
R4660:Gm13088 UTSW 4 143654277 missense probably benign 0.01
R4857:Gm13088 UTSW 4 143656588 missense possibly damaging 0.65
R4888:Gm13088 UTSW 4 143654401 missense probably benign 0.33
R5004:Gm13088 UTSW 4 143654136 missense probably benign
R5242:Gm13088 UTSW 4 143655611 missense probably benign 0.38
R5246:Gm13088 UTSW 4 143655557 missense probably benign 0.00
R5596:Gm13088 UTSW 4 143654455 missense probably damaging 1.00
R5735:Gm13088 UTSW 4 143654635 missense probably damaging 1.00
R5841:Gm13088 UTSW 4 143655539 missense possibly damaging 0.95
R5982:Gm13088 UTSW 4 143654464 missense probably damaging 0.99
R6052:Gm13088 UTSW 4 143655652 missense probably damaging 1.00
R6169:Gm13088 UTSW 4 143654115 missense probably benign 0.04
R6403:Gm13088 UTSW 4 143655773 nonsense probably null
R6584:Gm13088 UTSW 4 143655470 missense possibly damaging 0.74
R6898:Gm13088 UTSW 4 143655483 missense probably damaging 1.00
R7438:Gm13088 UTSW 4 143655560 missense probably damaging 0.96
R7563:Gm13088 UTSW 4 143654105 nonsense probably null
X0021:Gm13088 UTSW 4 143655748 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTTGGCCCTGAGCATATCCAGGAC -3'
(R):5'- TGCTGTAGTTTCCAGCAAGGCAC -3'

Sequencing Primer
(F):5'- CTGAGCATATCCAGGACTTCAGG -3'
(R):5'- GTTTCCAGCAAGGCACTGAATC -3'
Posted On2013-06-14