Incidental Mutation 'R0167:Olfr611'
ID50132
Institutional Source Beutler Lab
Gene Symbol Olfr611
Ensembl Gene ENSMUSG00000096584
Gene Nameolfactory receptor 611
SynonymsMOR15-4, MOR15-1, GA_x6K02T2PBJ9-6236637-6235666
MMRRC Submission 038443-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R0167 (G1)
Quality Score40
Status Validated (trace)
Chromosome7
Chromosomal Location103516465-103520846 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 103517501 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 294 (Y294*)
Ref Sequence ENSEMBL: ENSMUSP00000149114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078108] [ENSMUST00000216074]
Predicted Effect probably null
Transcript: ENSMUST00000078108
AA Change: Y294*
SMART Domains Protein: ENSMUSP00000077246
Gene: ENSMUSG00000096584
AA Change: Y294*

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 5.6e-110 PFAM
Pfam:7TM_GPCR_Srsx 37 309 4.6e-11 PFAM
Pfam:7tm_1 43 294 1e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216074
AA Change: Y294*
Meta Mutation Damage Score 0.6568 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 T C 9: 107,929,770 F431L probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Bsn T C 9: 108,125,986 T407A probably benign Het
Ccdc96 T C 5: 36,485,153 F168L probably benign Het
Cckar A T 5: 53,706,453 S55R probably damaging Het
Cdh5 A C 8: 104,136,735 I426L possibly damaging Het
Clcn1 T C 6: 42,286,836 Y24H probably damaging Het
Clpx G A 9: 65,316,737 R271K possibly damaging Het
Col6a3 C T 1: 90,798,173 G1978D probably damaging Het
Cpne2 T C 8: 94,568,579 probably benign Het
D630023F18Rik A G 1: 65,117,181 V51A possibly damaging Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Dlk2 C A 17: 46,302,604 R262S possibly damaging Het
Dubr G T 16: 50,732,644 noncoding transcript Het
Elane T A 10: 79,887,099 probably null Het
Eya2 T G 2: 165,716,112 S209R possibly damaging Het
Fam171a1 C T 2: 3,186,432 S112L probably damaging Het
Fsip2 T A 2: 82,980,807 M2490K possibly damaging Het
Galnt14 T C 17: 73,522,720 T277A probably damaging Het
Gm5771 T A 6: 41,396,261 probably benign Het
Golga1 T C 2: 39,047,648 N128S probably benign Het
Hdac2 T C 10: 37,000,372 V461A probably benign Het
Hey2 A G 10: 30,840,665 V34A probably benign Het
Hist1h1t T C 13: 23,695,903 V13A probably benign Het
Ift22 T C 5: 136,911,891 C137R probably benign Het
Lrp2 T C 2: 69,425,658 D4657G possibly damaging Het
Lrrn3 T A 12: 41,454,015 Q101L probably damaging Het
Med25 A G 7: 44,883,097 probably null Het
Mup5 T A 4: 61,833,782 probably null Het
Olfr1497 T C 19: 13,795,567 T15A probably benign Het
Olfr205 A T 16: 59,328,974 C178* probably null Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Parg T C 14: 32,217,736 probably null Het
Prep A G 10: 45,158,230 probably null Het
Psip1 T C 4: 83,466,818 probably null Het
Rbbp8 T A 18: 11,660,922 Y30* probably null Het
Rhbdd1 T C 1: 82,342,784 V163A probably benign Het
Setd2 T A 9: 110,573,782 N1830K probably damaging Het
Shc4 T G 2: 125,723,013 N122T probably benign Het
Shroom3 T C 5: 92,948,395 probably benign Het
Snx14 A T 9: 88,407,416 L261Q probably damaging Het
St8sia1 A G 6: 142,914,181 probably benign Het
Thbs2 A T 17: 14,667,525 probably benign Het
Tpp2 T C 1: 43,970,488 V494A probably benign Het
Trdmt1 A T 2: 13,516,018 F358I probably damaging Het
Ttn T A 2: 76,889,523 probably benign Het
Uggt1 A G 1: 36,170,197 probably null Het
Uhrf1bp1 C T 17: 27,880,202 T246M possibly damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vstm2a T A 11: 16,258,044 F13I probably damaging Het
Zfp804a T G 2: 82,256,516 F230V probably damaging Het
Other mutations in Olfr611
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Olfr611 APN 7 103517934 missense probably damaging 1.00
IGL01950:Olfr611 APN 7 103518265 missense probably benign 0.34
IGL02897:Olfr611 APN 7 103518130 missense probably benign 0.01
IGL02968:Olfr611 APN 7 103518259 missense probably damaging 0.99
R0739:Olfr611 UTSW 7 103517724 missense probably damaging 1.00
R2992:Olfr611 UTSW 7 103517770 missense probably damaging 0.98
R4094:Olfr611 UTSW 7 103518037 missense possibly damaging 0.93
R4451:Olfr611 UTSW 7 103517977 missense probably damaging 1.00
R4735:Olfr611 UTSW 7 103517823 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTCATGACACAAACTTACAAGAGTGCCT -3'
(R):5'- TCTCATCTGTGTGCTGTGGTCCT -3'

Sequencing Primer
(F):5'- caaccatccctaattccaaatcc -3'
(R):5'- TCTTCTTCACACCCATGATCTG -3'
Posted On2013-06-14