Incidental Mutation 'R5664:Avl9'
ID501331
Institutional Source Beutler Lab
Gene Symbol Avl9
Ensembl Gene ENSMUSG00000029787
Gene NameAVL9 cell migration associated
SynonymsD730049P16Rik, 5830411G16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R5664 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location56714899-56761912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56753839 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 583 (S583P)
Ref Sequence ENSEMBL: ENSMUSP00000031805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031805]
Predicted Effect probably damaging
Transcript: ENSMUST00000031805
AA Change: S583P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031805
Gene: ENSMUSG00000029787
AA Change: S583P

DomainStartEndE-ValueType
Pfam:Afi1 15 102 3.8e-11 PFAM
Pfam:Avl9 16 521 7.1e-160 PFAM
Pfam:DUF2347 19 175 1.6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176560
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,994 probably null Het
1810032O08Rik A T 11: 116,672,664 T27S possibly damaging Het
4930432K21Rik A T 8: 84,166,659 I152F probably benign Het
9430015G10Rik T A 4: 156,123,559 L112H probably damaging Het
Acaca T C 11: 84,243,384 L441P probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arsj A T 3: 126,438,657 I351F probably damaging Het
Atp6v1b2 A G 8: 69,107,620 T373A probably damaging Het
Atr C A 9: 95,905,813 N1486K probably benign Het
Bptf A T 11: 107,073,699 D1493E probably benign Het
C2cd2l T C 9: 44,313,772 E548G probably damaging Het
Capn3 G A 2: 120,477,025 R15Q probably benign Het
Ccl3 A G 11: 83,649,213 F22S probably benign Het
Clcf1 T C 19: 4,222,096 F69S probably damaging Het
Col13a1 T C 10: 61,851,116 E170G probably damaging Het
Dhx29 T A 13: 112,946,879 F489L probably damaging Het
Dhx8 A T 11: 101,740,751 N390I probably damaging Het
Dkk1 T A 19: 30,548,789 Y135F probably benign Het
Edil3 G T 13: 89,319,713 V446F probably damaging Het
Epha5 T A 5: 84,331,866 E93V probably damaging Het
Epsti1 C T 14: 77,963,664 T196I possibly damaging Het
Fras1 T C 5: 96,728,535 S2376P possibly damaging Het
Frem2 A G 3: 53,652,490 V1532A probably benign Het
Fsip2 T A 2: 82,988,095 M4724K probably benign Het
Gcat T A 15: 79,043,073 L238Q probably damaging Het
Gimap6 T C 6: 48,702,275 K276E probably benign Het
Gjb5 T A 4: 127,355,929 I141F probably benign Het
Glt6d1 T C 2: 25,814,180 I7V probably benign Het
Gm37596 A G 3: 93,692,687 F125S probably benign Het
Gm5771 C T 6: 41,394,671 P17L probably benign Het
Gm6169 C A 13: 97,099,121 L39F probably damaging Het
Gtf2h5 G A 17: 6,084,524 G30R probably damaging Het
Herc6 C A 6: 57,618,684 T449K probably benign Het
Hpn A T 7: 31,099,262 Y132N probably damaging Het
Hpx A T 7: 105,595,148 M190K probably benign Het
Inf2 A G 12: 112,611,728 H1151R unknown Het
Krt74 A G 15: 101,760,579 noncoding transcript Het
Loxl3 G A 6: 83,049,882 S564N probably benign Het
Map7 T A 10: 20,267,359 V418E unknown Het
Mrpl37 T C 4: 107,064,391 N214D probably benign Het
Mthfr T C 4: 148,055,466 Y656H probably damaging Het
Myo9b A G 8: 71,359,882 D2099G probably benign Het
Nktr T A 9: 121,749,417 C825* probably null Het
Nomo1 A G 7: 46,076,157 E1029G probably benign Het
Nup133 T C 8: 123,906,281 D1037G probably benign Het
Olfr1271 A G 2: 90,265,615 F272L probably damaging Het
Olfr153 T C 2: 87,532,834 L267P probably benign Het
Pcdhb14 T A 18: 37,448,996 V385D possibly damaging Het
Pik3c2g T C 6: 139,737,007 L38P probably damaging Het
Pkd1 A T 17: 24,569,371 D701V probably damaging Het
Pnpla6 A G 8: 3,537,478 T1070A probably damaging Het
Ppl T C 16: 5,106,055 D185G probably benign Het
Prune1 A T 3: 95,258,178 L261Q probably damaging Het
Qser1 A T 2: 104,778,196 L1444I probably damaging Het
Serpina6 A C 12: 103,654,467 C8G probably damaging Het
Sla2 A T 2: 156,874,999 D180E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Tbx3 A G 5: 119,678,731 K311R possibly damaging Het
Thbs2 A T 17: 14,689,837 C167S probably damaging Het
Trak1 T A 9: 121,472,307 C710S possibly damaging Het
Tsks G A 7: 44,953,784 E337K probably damaging Het
Vcpip1 A G 1: 9,746,379 I593T probably damaging Het
Vmn2r118 A G 17: 55,592,765 I713T possibly damaging Het
Vmn2r23 C T 6: 123,713,074 T303M probably damaging Het
Vmn2r68 A T 7: 85,233,770 M258K probably benign Het
Vmn2r76 A G 7: 86,245,994 probably null Het
Wap A G 11: 6,638,609 I5T possibly damaging Het
Zfp235 A C 7: 24,142,151 H665P probably damaging Het
Other mutations in Avl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Avl9 APN 6 56725090 missense probably damaging 1.00
IGL01433:Avl9 APN 6 56753397 missense probably damaging 0.99
IGL02865:Avl9 APN 6 56736873 missense probably damaging 1.00
IGL02932:Avl9 APN 6 56736551 missense probably benign 0.00
Atlanta UTSW 6 56753390 missense
H8562:Avl9 UTSW 6 56757310 missense probably damaging 1.00
H8786:Avl9 UTSW 6 56757310 missense probably damaging 1.00
R0003:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0029:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0102:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0103:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0122:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0147:Avl9 UTSW 6 56736502 missense probably benign 0.00
R0372:Avl9 UTSW 6 56726324 critical splice donor site probably null
R0446:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0600:Avl9 UTSW 6 56736906 missense probably benign 0.03
R0667:Avl9 UTSW 6 56736483 missense probably benign 0.00
R1560:Avl9 UTSW 6 56725128 nonsense probably null
R1566:Avl9 UTSW 6 56736482 nonsense probably null
R2069:Avl9 UTSW 6 56736435 splice site probably benign
R2362:Avl9 UTSW 6 56736570 missense probably benign 0.07
R2483:Avl9 UTSW 6 56736843 missense probably benign
R2941:Avl9 UTSW 6 56753885 missense probably benign 0.00
R3028:Avl9 UTSW 6 56730687 unclassified probably benign
R3437:Avl9 UTSW 6 56736627 missense probably benign
R3690:Avl9 UTSW 6 56736827 missense probably benign
R3691:Avl9 UTSW 6 56736827 missense probably benign
R3947:Avl9 UTSW 6 56728665 critical splice donor site probably null
R3948:Avl9 UTSW 6 56728665 critical splice donor site probably null
R3949:Avl9 UTSW 6 56728665 critical splice donor site probably null
R3972:Avl9 UTSW 6 56743408 missense probably damaging 1.00
R4734:Avl9 UTSW 6 56736494 missense probably damaging 0.96
R4739:Avl9 UTSW 6 56726309 missense probably damaging 1.00
R5661:Avl9 UTSW 6 56725102 nonsense probably null
R6010:Avl9 UTSW 6 56753390 missense possibly damaging 0.54
R6615:Avl9 UTSW 6 56753885 missense probably benign 0.00
R6719:Avl9 UTSW 6 56753385 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTCAGAAATCATATCTGTCAAG -3'
(R):5'- TGTAGTGTCTCTAAAAGCCCC -3'

Sequencing Primer
(F):5'- ATCATATCTGTCAAGAAGATTTAGCC -3'
(R):5'- AAAGCCCCCTTGTATTGTTATGTG -3'
Posted On2017-12-01