Incidental Mutation 'R5665:Dppa4'
ID501337
Institutional Source Beutler Lab
Gene Symbol Dppa4
Ensembl Gene ENSMUSG00000058550
Gene Namedevelopmental pluripotency associated 4
Synonyms2410091M23Rik, ECAT15-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5665 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location48283733-48294237 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48291015 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 121 (L121P)
Ref Sequence ENSEMBL: ENSMUSP00000093749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050705] [ENSMUST00000096045]
Predicted Effect probably benign
Transcript: ENSMUST00000050705
AA Change: L69P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093748
Gene: ENSMUSG00000058550
AA Change: L69P

DomainStartEndE-ValueType
low complexity region 23 43 N/A INTRINSIC
low complexity region 125 142 N/A INTRINSIC
Pfam:DCR 169 236 1.2e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096045
AA Change: L121P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093749
Gene: ENSMUSG00000058550
AA Change: L121P

DomainStartEndE-ValueType
low complexity region 23 43 N/A INTRINSIC
low complexity region 70 80 N/A INTRINSIC
Blast:SAP 81 115 3e-9 BLAST
Pfam:Dppa2_A 123 158 1.2e-3 PFAM
Pfam:Dppa2_A 173 219 1.1e-9 PFAM
Pfam:DCR 221 287 1.5e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231359
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear factor that is involved in the maintenance of pluripotency in stem cells and essential for embryogenesis. The encoded protein has a scaffold-attachment factor A/B, acinus and PIAS (SAP) domain that binds DNA and is thought to modify chromatin. Mice with a homozygous knockout of the orthologous gene die during late embryonic development or within hours after birth. Knockout embryos are normal in size at embryonic day 18.5 but exhibit skeletal and lung tissue abnormalities. This gene, when mutated, is highly expressed in embryonal carcinomas, pluripotent germ cell tumors, and other cancers and is thought to play an important role in tumor progression. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit perinatal and postnatal lethality, abnormal lung morphology, skeletal defects, and a maternal effect on female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acaca G T 11: 84,245,294 E492* probably null Het
Acp7 T A 7: 28,616,543 K206M probably benign Het
Agbl1 T A 7: 76,589,503 F584I probably damaging Het
Ahi1 A G 10: 21,055,047 I929V possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arhgef40 A G 14: 52,000,900 I1279V possibly damaging Het
Arl14 A C 3: 69,223,038 T173P probably damaging Het
Asap1 A G 15: 64,312,453 S44P probably damaging Het
Btbd7 C A 12: 102,785,197 A1103S probably benign Het
Capn10 T A 1: 92,937,931 probably null Het
Capn7 T C 14: 31,369,802 F719L probably benign Het
Casp7 G A 19: 56,440,982 D267N probably benign Het
Ccdc13 C A 9: 121,814,290 K348N probably damaging Het
Chchd1 T C 14: 20,703,110 F13L probably benign Het
Clcn6 T A 4: 148,014,561 M442L possibly damaging Het
Col6a3 T C 1: 90,827,880 E229G probably benign Het
Cyb5r3 A G 15: 83,154,554 F278S probably damaging Het
Dhx16 C T 17: 35,891,086 Q1002* probably null Het
Dpyd A G 3: 118,917,092 E383G probably damaging Het
Eif4g3 A G 4: 138,126,589 T489A probably benign Het
Elovl1 G T 4: 118,431,635 V174L probably damaging Het
Elp3 T C 14: 65,551,402 K392E possibly damaging Het
Fancd2os C A 6: 113,598,024 W7L probably damaging Het
Fchsd2 A G 7: 101,110,784 T23A possibly damaging Het
Gabrp C G 11: 33,554,308 A336P possibly damaging Het
Gcm2 T A 13: 41,109,911 Y15F possibly damaging Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Herc1 A G 9: 66,465,435 E3091G probably damaging Het
Homer1 A T 13: 93,356,102 M184L probably benign Het
Izumo1r T C 9: 14,900,849 E117G probably damaging Het
Kcnt1 C T 2: 25,901,909 Q590* probably null Het
Lama1 G T 17: 67,770,987 C1139F probably damaging Het
Med29 C T 7: 28,386,814 A190T probably benign Het
Mgea5 A C 19: 45,776,997 S124A probably benign Het
Muc4 T C 16: 32,750,782 V220A probably benign Het
Mxra8 G T 4: 155,842,921 V388L probably benign Het
Myo5a T C 9: 75,144,181 probably null Het
Myrip A G 9: 120,461,433 Y706C probably damaging Het
Nphp4 T C 4: 152,506,485 V313A probably benign Het
Olfm2 T G 9: 20,668,544 probably null Het
Olfr1113 T A 2: 87,213,728 S279T probably benign Het
Olfr248 T C 1: 174,391,375 F102S probably damaging Het
Pcdh15 C T 10: 74,626,788 P1398L probably damaging Het
Pdpr A G 8: 111,114,811 E225G possibly damaging Het
Pigs C A 11: 78,328,769 probably null Het
Pkhd1 T A 1: 20,588,531 T159S probably damaging Het
Plk4 A G 3: 40,813,586 T87A possibly damaging Het
Plxna4 T C 6: 32,215,722 Y768C probably damaging Het
Prl3d3 T A 13: 27,159,081 probably null Het
Pygb T C 2: 150,820,888 probably null Het
Rnf114 T C 2: 167,510,934 I118T possibly damaging Het
Sbno2 A G 10: 80,058,453 L1099P probably benign Het
Scaper T C 9: 55,807,632 K791E probably damaging Het
Serping1 T C 2: 84,771,545 T194A probably damaging Het
Slc12a9 A G 5: 137,321,403 S617P possibly damaging Het
Slk G A 19: 47,636,457 R1039H probably damaging Het
Sntb1 T A 15: 55,792,139 E227V probably benign Het
Sostdc1 C A 12: 36,314,408 P39T probably benign Het
Spred1 C T 2: 117,153,005 R16* probably null Het
Srpk2 A G 5: 23,518,477 I547T probably damaging Het
Stt3a A G 9: 36,759,314 Y54H probably damaging Het
Stt3b A T 9: 115,266,147 L272H probably damaging Het
Syne2 T A 12: 76,108,217 probably null Het
Uso1 A T 5: 92,198,337 E793V possibly damaging Het
Usp15 A T 10: 123,130,987 L476* probably null Het
Vmn1r189 T C 13: 22,102,166 Y167C probably damaging Het
Vmn2r24 A G 6: 123,786,979 T272A possibly damaging Het
Vps13a A T 19: 16,668,690 H1994Q probably damaging Het
Zbtb10 T C 3: 9,265,192 S537P probably damaging Het
Zbtb12 T C 17: 34,895,883 S215P possibly damaging Het
Zfp346 T C 13: 55,113,102 M81T probably benign Het
Zfp800 T C 6: 28,244,513 D151G probably null Het
Other mutations in Dppa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Dppa4 APN 16 48291083 missense possibly damaging 0.78
IGL02527:Dppa4 APN 16 48289093 missense possibly damaging 0.93
R0138:Dppa4 UTSW 16 48291062 missense probably benign 0.25
R0346:Dppa4 UTSW 16 48289324 splice site probably benign
R1216:Dppa4 UTSW 16 48292980 missense possibly damaging 0.91
R1453:Dppa4 UTSW 16 48291233 missense probably damaging 1.00
R1852:Dppa4 UTSW 16 48287884 missense probably damaging 0.99
R4452:Dppa4 UTSW 16 48289336 missense probably benign 0.38
R5133:Dppa4 UTSW 16 48292971 missense probably benign 0.18
R5616:Dppa4 UTSW 16 48291030 missense probably damaging 1.00
R5947:Dppa4 UTSW 16 48291108 missense possibly damaging 0.78
R5993:Dppa4 UTSW 16 48289346 nonsense probably null
R6018:Dppa4 UTSW 16 48289127 nonsense probably null
R6701:Dppa4 UTSW 16 48291311 nonsense probably null
R6719:Dppa4 UTSW 16 48287884 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCATCCTATTATCACAGGAGC -3'
(R):5'- GTGGTGCTGACTTCCTCATAG -3'

Sequencing Primer
(F):5'- CTCAGTGGTAGAGCGCTTACCTAG -3'
(R):5'- GCTGACTTCCTCATAGAGCATAGG -3'
Posted On2017-12-01