Incidental Mutation 'R5717:Mypn'
ID501378
Institutional Source Beutler Lab
Gene Symbol Mypn
Ensembl Gene ENSMUSG00000020067
Gene Namemyopalladin
Synonyms1110056A04Rik
MMRRC Submission 043337-MU
Accession Numbers

Genbank: NM_182992; MGI: 1916052

Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R5717 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location63115795-63203952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63127776 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 972 (V972A)
Ref Sequence ENSEMBL: ENSMUSP00000093240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095580]
Predicted Effect probably damaging
Transcript: ENSMUST00000095580
AA Change: V972A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093240
Gene: ENSMUSG00000020067
AA Change: V972A

DomainStartEndE-ValueType
low complexity region 46 56 N/A INTRINSIC
low complexity region 225 245 N/A INTRINSIC
IGc2 279 346 2.16e-8 SMART
low complexity region 384 405 N/A INTRINSIC
IGc2 444 519 1.69e-10 SMART
low complexity region 636 648 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 721 741 N/A INTRINSIC
low complexity region 779 794 N/A INTRINSIC
low complexity region 826 838 N/A INTRINSIC
low complexity region 922 933 N/A INTRINSIC
IGc2 953 1022 1.64e-8 SMART
IGc2 1080 1148 3.67e-11 SMART
IG 1173 1259 1.17e-4 SMART
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Striated muscle in vertebrates comprises large proteins which must be organized properly to contract efficiently. Z-lines in striated muscle are a sign of this organization, representing the ends of actin thin filaments, titin, nebulin or nebulette and accessory proteins required for structure and function. This gene encodes a protein which interacts with nebulin in skeletal muscle or nebulette in cardiac muscle and alpha-actinin. In addition, this gene product can interact with a protein with the I-band indicating it has a regulatory as well as structural function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(51) : Gene trapped(51)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik A T 19: 42,053,045 H205L probably benign Het
Acss2 T C 2: 155,561,153 L617S probably damaging Het
Adgrl4 T C 3: 151,492,334 V77A probably benign Het
Adnp2 A G 18: 80,128,264 S977P probably benign Het
Ankrd11 T C 8: 122,892,638 K1492E possibly damaging Het
B4galt5 G A 2: 167,306,629 R190C probably damaging Het
Bbs1 A G 19: 4,897,326 V355A possibly damaging Het
Cenpj GTTTT GTTTTT 14: 56,553,521 probably null Het
Ckap2 T C 8: 22,175,047 E467G probably damaging Het
Cry1 A T 10: 85,146,416 H355Q probably damaging Het
Cspg4 G T 9: 56,885,798 M272I probably benign Het
Dicer1 T A 12: 104,705,128 Y961F probably damaging Het
Dirc2 A G 16: 35,719,429 F341L probably benign Het
Epha2 A T 4: 141,322,071 M689L probably benign Het
Foxc1 C T 13: 31,807,488 A94V probably benign Het
Fras1 T C 5: 96,781,737 V4000A possibly damaging Het
Frmd8 G T 19: 5,873,368 probably benign Het
Gm5218 A G 15: 81,499,277 noncoding transcript Het
Gm7735 T C 16: 89,169,542 L18P unknown Het
Hr C T 14: 70,566,176 T808I probably benign Het
Hyal6 T C 6: 24,743,691 M462T probably benign Het
Igkv6-20 T A 6: 70,336,428 probably benign Het
Igkv8-27 T A 6: 70,171,934 T59S probably benign Het
Itga11 A G 9: 62,752,249 T428A probably benign Het
Klk1b16 A G 7: 44,139,489 I49V probably benign Het
Matn2 G T 15: 34,399,091 E375* probably null Het
Msgn1 T C 12: 11,208,518 Y144C probably damaging Het
Myh1 A G 11: 67,208,956 N564S probably benign Het
Olfr1209 T C 2: 88,910,022 I124V possibly damaging Het
Olfr235 A G 19: 12,269,156 K309E probably benign Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Ppp2r5d A G 17: 46,687,894 S81P probably damaging Het
Ptgis C T 2: 167,208,364 probably benign Het
Ptprr A G 10: 116,048,113 N25S probably benign Het
Rnf123 G A 9: 108,067,424 T456I probably damaging Het
Rpl6l T C 10: 111,126,023 noncoding transcript Het
Rps25 A G 9: 44,408,750 Y23C probably benign Het
Sec24a A G 11: 51,707,210 V879A probably benign Het
Sema6a G A 18: 47,249,263 A739V probably benign Het
Senp6 A T 9: 80,092,312 I4F probably damaging Het
Stoml3 A T 3: 53,505,516 Q197L probably damaging Het
Ttn T A 2: 76,747,747 K24267N probably damaging Het
Vmn1r43 T C 6: 89,869,923 S194G probably damaging Het
Vmn2r17 C T 5: 109,427,274 T149I possibly damaging Het
Wdr72 T A 9: 74,148,205 Y239N probably damaging Het
Zfp423 A T 8: 87,686,559 probably null Het
Zfp759 T A 13: 67,138,708 C114S probably damaging Het
Other mutations in Mypn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Mypn APN 10 63192423 missense probably damaging 1.00
IGL01137:Mypn APN 10 63152854 missense probably benign 0.12
IGL01383:Mypn APN 10 63135797 missense probably damaging 1.00
IGL01560:Mypn APN 10 63134964 missense probably benign 0.27
IGL01569:Mypn APN 10 63127759 missense probably damaging 1.00
IGL02197:Mypn APN 10 63123278 missense possibly damaging 0.69
IGL02829:Mypn APN 10 63192586 missense probably benign 0.01
IGL03221:Mypn APN 10 63131123 missense probably damaging 1.00
IGL03377:Mypn APN 10 63192865 missense probably benign 0.01
2107:Mypn UTSW 10 63203751 utr 5 prime probably benign
PIT4576001:Mypn UTSW 10 63120071 missense probably damaging 1.00
R0115:Mypn UTSW 10 63192380 splice site probably benign
R0377:Mypn UTSW 10 63127622 unclassified probably benign
R0480:Mypn UTSW 10 63193203 missense probably benign 0.01
R0581:Mypn UTSW 10 63162244 missense probably benign 0.06
R0669:Mypn UTSW 10 63134923 splice site probably benign
R0822:Mypn UTSW 10 63169256 missense probably damaging 1.00
R1209:Mypn UTSW 10 63118499 missense probably damaging 1.00
R1401:Mypn UTSW 10 63152857 missense probably damaging 0.96
R1513:Mypn UTSW 10 63169368 missense probably damaging 0.99
R1750:Mypn UTSW 10 63136197 missense probably benign 0.01
R1780:Mypn UTSW 10 63121964 missense probably damaging 1.00
R1791:Mypn UTSW 10 63125693 missense probably damaging 0.97
R1859:Mypn UTSW 10 63146190 missense probably benign
R1903:Mypn UTSW 10 63123397 missense probably benign 0.06
R2275:Mypn UTSW 10 63131069 missense probably damaging 1.00
R2420:Mypn UTSW 10 63192869 nonsense probably null
R3425:Mypn UTSW 10 63118417 splice site probably benign
R3767:Mypn UTSW 10 63125707 missense possibly damaging 0.88
R3768:Mypn UTSW 10 63125707 missense possibly damaging 0.88
R3770:Mypn UTSW 10 63125707 missense possibly damaging 0.88
R3777:Mypn UTSW 10 63147982 missense possibly damaging 0.92
R3785:Mypn UTSW 10 63193182 missense probably benign 0.43
R3888:Mypn UTSW 10 63192510 missense probably damaging 1.00
R4289:Mypn UTSW 10 63131182 missense probably damaging 1.00
R4301:Mypn UTSW 10 63118484 missense probably damaging 1.00
R4366:Mypn UTSW 10 63192708 missense probably benign 0.00
R4459:Mypn UTSW 10 63192432 missense probably damaging 1.00
R4921:Mypn UTSW 10 63147936 missense possibly damaging 0.75
R4995:Mypn UTSW 10 63119968 intron probably null
R5064:Mypn UTSW 10 63123371 missense possibly damaging 0.68
R5083:Mypn UTSW 10 63118528 missense probably damaging 0.98
R5108:Mypn UTSW 10 63136294 missense probably damaging 1.00
R5399:Mypn UTSW 10 63120186 missense probably benign 0.03
R5438:Mypn UTSW 10 63135839 nonsense probably null
R5590:Mypn UTSW 10 63120048 missense probably benign 0.27
R5652:Mypn UTSW 10 63135801 missense probably damaging 1.00
R5970:Mypn UTSW 10 63131023 missense probably benign 0.36
R6616:Mypn UTSW 10 63169312 missense probably damaging 1.00
R6930:Mypn UTSW 10 63116939 missense probably damaging 1.00
R6987:Mypn UTSW 10 63193131 missense probably benign 0.00
R7020:Mypn UTSW 10 63192510 missense probably damaging 1.00
R7081:Mypn UTSW 10 63134958 missense probably damaging 1.00
X0022:Mypn UTSW 10 63136063 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTACGCACAATCACGCCTC -3'
(R):5'- TGTATAGGTACAGGTGGAGGTACAC -3'

Sequencing Primer
(F):5'- CCTTAAGGTCTCATTCACAAGC -3'
(R):5'- CTTGCAACAGAGATGTCC -3'
Posted On2017-12-01