Incidental Mutation 'R0180:Nptxr'
ID50138
Institutional Source Beutler Lab
Gene Symbol Nptxr
Ensembl Gene ENSMUSG00000022421
Gene Nameneuronal pentraxin receptor
SynonymsNPR, D15Bwg0580e, 5730406O18Rik, 1700036C17Rik, NPCD
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0180 (G1)
Quality Score150
Status Validated (trace)
Chromosome15
Chromosomal Location79786351-79804766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79794403 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 228 (M228V)
Ref Sequence ENSEMBL: ENSMUSP00000023057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023057] [ENSMUST00000023060] [ENSMUST00000089299] [ENSMUST00000175858]
Predicted Effect probably benign
Transcript: ENSMUST00000023057
AA Change: M228V

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000023057
Gene: ENSMUSG00000022421
AA Change: M228V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 43 53 N/A INTRINSIC
low complexity region 57 71 N/A INTRINSIC
low complexity region 77 93 N/A INTRINSIC
PTX 281 487 2.17e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000023060
AA Change: M107V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023060
Gene: ENSMUSG00000089837
AA Change: M107V

DomainStartEndE-ValueType
CHROMO 10 62 1.46e-18 SMART
PTX 160 366 2.17e-97 SMART
Predicted Effect unknown
Transcript: ENSMUST00000089299
AA Change: M204V
SMART Domains Protein: ENSMUSP00000086714
Gene: ENSMUSG00000089837
AA Change: M204V

DomainStartEndE-ValueType
CHROMO 10 62 1.46e-18 SMART
low complexity region 98 115 N/A INTRINSIC
PTX 257 463 2.17e-97 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125283
Predicted Effect probably benign
Transcript: ENSMUST00000175858
AA Change: M228V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000135855
Gene: ENSMUSG00000022421
AA Change: M228V

DomainStartEndE-ValueType
CHROMO 10 62 1.46e-18 SMART
PTX 160 366 2.17e-97 SMART
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 89.5%
Validation Efficiency 77% (53/69)
MGI Phenotype FUNCTION: This gene encodes a protein similar to the rat neuronal pentraxin receptor. The rat pentraxin receptor is an integral membrane protein that is thought to mediate neuronal uptake of the snake venom toxin, taipoxin, and its transport into the synapses. Studies in rat indicate that translation of this mRNA initiates at a non-AUG (CUG) codon. This may also be true for mouse and human, based on strong sequence conservation amongst these species. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation of this gene display a mild alteration in retinal ganglion cell innervation but are fertile with no obvious behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T A 19: 21,652,639 N24Y probably damaging Het
2810408A11Rik A T 11: 69,898,876 M311K probably benign Het
Ackr2 T C 9: 121,908,916 I119T probably benign Het
Adamtsl3 A G 7: 82,575,990 M336V probably benign Het
Adhfe1 T A 1: 9,563,857 F374I probably benign Het
Apob C T 12: 8,008,285 Q2256* probably null Het
Arg1 T C 10: 24,916,830 I169V probably benign Het
Atxn1 A G 13: 45,557,548 V636A probably damaging Het
B3gnt5 T A 16: 19,769,100 I23K possibly damaging Het
Casc1 A G 6: 145,183,218 probably benign Het
Catsperg1 A T 7: 29,190,431 probably null Het
Celf3 T A 3: 94,485,340 F115L probably damaging Het
Cep192 T A 18: 67,835,488 H984Q probably damaging Het
Col18a1 A G 10: 77,096,517 V493A probably benign Het
Col5a2 C T 1: 45,411,460 G376S probably damaging Het
Colec12 A G 18: 9,848,890 H356R probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cracr2a T C 6: 127,604,074 probably null Het
Ctsr T C 13: 61,162,745 H62R probably damaging Het
Cyp4f40 G T 17: 32,659,667 W61L probably benign Het
Dnah9 T G 11: 66,147,290 H140P probably damaging Het
Dnm1 T G 2: 32,327,993 I464L probably damaging Het
Dnmt1 G A 9: 20,908,620 T1409I probably damaging Het
Dock1 G A 7: 135,098,837 D1109N probably damaging Het
Efhc1 A G 1: 20,967,489 M297V probably benign Het
Emcn A T 3: 137,418,994 probably null Het
Ephb1 A T 9: 101,927,504 M905K probably damaging Het
Fbxw10 A G 11: 62,853,096 Y276C probably benign Het
Fermt3 C A 19: 7,002,343 S474I possibly damaging Het
Frg1 T A 8: 41,399,068 probably null Het
Gbf1 T C 19: 46,285,722 S1732P probably benign Het
Gbp8 A C 5: 105,031,276 L119R probably damaging Het
Gldc C T 19: 30,100,817 A927T possibly damaging Het
Gm8836 T A 6: 70,260,405 probably benign Het
Grhl3 C T 4: 135,554,530 V344I probably benign Het
Hhipl1 T A 12: 108,328,070 L745H probably damaging Het
Ido1 T C 8: 24,593,140 I90V possibly damaging Het
Itpr2 T A 6: 146,501,909 probably benign Het
Kif1b T G 4: 149,213,659 S1029R probably damaging Het
Kmt2a G A 9: 44,826,851 probably benign Het
Limk1 T C 5: 134,669,261 N215D probably damaging Het
Lims2 A G 18: 31,956,315 K144E probably benign Het
Mfsd6l A T 11: 68,556,545 Q74L possibly damaging Het
Mroh1 T A 15: 76,428,250 S546T probably damaging Het
Ncbp3 T A 11: 73,064,978 probably null Het
Nlrx1 G A 9: 44,255,459 H776Y possibly damaging Het
Nsf T A 11: 103,930,780 L13F probably damaging Het
Nyap1 T C 5: 137,738,021 E68G probably damaging Het
Olfr550 A G 7: 102,579,032 Y179C probably damaging Het
Olfr9 A T 10: 128,990,834 R307S possibly damaging Het
Pcdhb9 A G 18: 37,402,254 N434D probably damaging Het
Pgm5 T C 19: 24,815,763 D313G probably damaging Het
Pkdcc G A 17: 83,221,870 probably null Het
Pkp1 T C 1: 135,886,800 K261R probably benign Het
Pnpla6 A G 8: 3,524,250 probably null Het
Polr3b A G 10: 84,622,515 T17A probably benign Het
Ppt2 A T 17: 34,626,503 M98K probably damaging Het
Rasal3 T C 17: 32,399,405 D142G probably benign Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Rhbdf1 A T 11: 32,210,042 V153D possibly damaging Het
Slc6a3 C T 13: 73,562,336 T355M probably damaging Het
Snrnp35 A T 5: 124,490,820 probably benign Het
Sorcs2 A T 5: 36,153,845 I37N probably damaging Het
Tecta G T 9: 42,366,813 P1133Q probably benign Het
Tmem145 A G 7: 25,314,699 I413V probably benign Het
Trappc11 G T 8: 47,527,974 T144K possibly damaging Het
Triml2 A T 8: 43,190,309 I223L probably benign Het
Ube2g2 T A 10: 77,630,739 N19K possibly damaging Het
Ubqln3 A G 7: 104,141,840 Y348H probably damaging Het
Wfs1 A G 5: 36,967,028 F840L probably damaging Het
Zc3h11a T C 1: 133,621,611 I771V probably benign Het
Zdhhc23 G A 16: 43,973,703 P203S probably benign Het
Zfp106 T G 2: 120,533,875 T684P probably damaging Het
Zfp217 A T 2: 170,120,137 L90Q probably damaging Het
Other mutations in Nptxr
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0208:Nptxr UTSW 15 79789715 missense probably null 1.00
R1055:Nptxr UTSW 15 79790255 splice site probably benign
R1487:Nptxr UTSW 15 79789903 missense probably damaging 1.00
R4820:Nptxr UTSW 15 79792826 missense probably damaging 1.00
R5948:Nptxr UTSW 15 79789841 missense probably benign 0.42
R6357:Nptxr UTSW 15 79794315 missense possibly damaging 0.78
X0017:Nptxr UTSW 15 79789842 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACTTTGAAAGTGACAGCCATCCC -3'
(R):5'- TTTGCCCACCAGAAGCTAAGATCG -3'

Sequencing Primer
(F):5'- TTGTTCTACAGCCTCTGGAAG -3'
(R):5'- CAGAAGCTAAGATCGCCTGTG -3'
Posted On2013-06-14