Incidental Mutation 'R5757:Adcy5'
ID501382
Institutional Source Beutler Lab
Gene Symbol Adcy5
Ensembl Gene ENSMUSG00000022840
Gene Nameadenylate cyclase 5
SynonymsAC5
MMRRC Submission 043360-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R5757 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location35154877-35305738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 35272081 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 604 (R604L)
Ref Sequence ENSEMBL: ENSMUSP00000110563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114913]
Predicted Effect probably damaging
Transcript: ENSMUST00000114913
AA Change: R604L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110563
Gene: ENSMUSG00000022840
AA Change: R604L

DomainStartEndE-ValueType
low complexity region 47 59 N/A INTRINSIC
low complexity region 75 89 N/A INTRINSIC
low complexity region 107 150 N/A INTRINSIC
low complexity region 158 175 N/A INTRINSIC
low complexity region 181 208 N/A INTRINSIC
low complexity region 243 258 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
CYCc 424 623 2.62e-69 SMART
Pfam:DUF1053 669 762 1.8e-30 PFAM
transmembrane domain 794 816 N/A INTRINSIC
transmembrane domain 837 856 N/A INTRINSIC
transmembrane domain 910 932 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 985 1004 N/A INTRINSIC
CYCc 1032 1240 2.98e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232470
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-bound adenylyl cyclase enzymes. Adenylyl cyclases mediate G protein-coupled receptor signaling through the synthesis of the second messenger cAMP. Activity of the encoded protein is stimulated by the Gs alpha subunit of G protein-coupled receptors and is inhibited by protein kinase A, calcium and Gi alpha subunits. Single nucleotide polymorphisms in this gene may be associated with low birth weight and type 2 diabetes. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted inactivation of this gene has been shown to result in motor dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a C T 11: 110,042,968 A1204T probably benign Het
Ago4 A T 4: 126,526,084 N33K probably damaging Het
Arid5b T C 10: 68,102,079 Y406C probably damaging Het
Asgr1 A C 11: 70,054,952 H18P probably benign Het
Asph A C 4: 9,637,722 probably null Het
Brd4 G A 17: 32,201,298 probably benign Het
Ccdc150 T A 1: 54,263,620 I133N probably damaging Het
Cdon A C 9: 35,452,772 H62P probably damaging Het
Clec4b1 T A 6: 123,069,754 Y157* probably null Het
Clip1 G A 5: 123,627,397 T810I probably benign Het
Crocc A T 4: 141,043,564 L184Q probably damaging Het
Fat2 C T 11: 55,252,346 G4226R probably damaging Het
Fbxo30 T A 10: 11,290,421 C296S probably benign Het
Fndc3a T C 14: 72,556,585 K883E probably benign Het
Glyr1 A T 16: 5,018,992 M436K probably benign Het
Gm525 A T 11: 89,075,046 Q38L probably benign Het
Gnas T A 2: 174,345,247 V941D probably damaging Het
Hectd4 G C 5: 121,348,619 E3226Q possibly damaging Het
Ints13 G A 6: 146,550,106 R714C probably benign Het
Kif12 A T 4: 63,170,518 W182R probably damaging Het
Kif21a A G 15: 90,951,345 L1272P probably damaging Het
Klhl14 A C 18: 21,554,734 Y544D probably damaging Het
Kntc1 T C 5: 123,807,309 probably null Het
Lama1 G A 17: 67,738,787 R229Q possibly damaging Het
Ltbp1 T A 17: 75,273,949 probably null Het
Map4k5 A T 12: 69,824,655 C498S probably damaging Het
Myh9 A T 15: 77,771,162 V1198E probably benign Het
Ncoa6 T C 2: 155,411,608 D950G probably damaging Het
Obsl1 G T 1: 75,493,055 A1106D probably damaging Het
Olfr1034 T A 2: 86,046,566 V28E possibly damaging Het
Olfr1065 T C 2: 86,445,578 I135V probably benign Het
Otog T A 7: 46,241,121 probably null Het
Oxtr A T 6: 112,477,261 I14N probably damaging Het
Pfkfb3 A T 2: 11,480,330 S490R probably damaging Het
Polk A C 13: 96,484,252 M560R probably benign Het
Polq C T 16: 37,086,681 H2335Y probably benign Het
Prr14 T A 7: 127,475,553 V419D possibly damaging Het
Rflnb A G 11: 76,022,166 V132A probably damaging Het
Rxfp1 T G 3: 79,661,320 I283L possibly damaging Het
Ryr3 G A 2: 112,841,975 R1384C probably damaging Het
Scnn1g T A 7: 121,738,215 C100S probably damaging Het
Sfrp2 G C 3: 83,766,626 G29R possibly damaging Het
Spop A G 11: 95,490,382 H312R probably damaging Het
Tpx2 A G 2: 152,885,231 probably null Het
Wdr4 A T 17: 31,499,089 V337E probably damaging Het
Zbtb11 A G 16: 56,007,029 N953D probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Adcy5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Adcy5 APN 16 35253213 missense possibly damaging 0.49
IGL01583:Adcy5 APN 16 35283513 splice site probably benign
IGL01608:Adcy5 APN 16 35272165 missense probably damaging 1.00
IGL02097:Adcy5 APN 16 35272098 missense probably damaging 1.00
IGL02122:Adcy5 APN 16 35283612 splice site probably benign
IGL02532:Adcy5 APN 16 35272083 missense possibly damaging 0.79
IGL02814:Adcy5 APN 16 35303649 missense probably benign 0.08
IGL02877:Adcy5 APN 16 35298600 missense probably damaging 1.00
IGL03026:Adcy5 APN 16 35157042 missense probably benign 0.41
IGL03345:Adcy5 APN 16 35248814 missense probably benign 0.05
H8562:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
H8786:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
R0050:Adcy5 UTSW 16 35304303 utr 3 prime probably benign
R0091:Adcy5 UTSW 16 35270998 critical splice donor site probably null
R0112:Adcy5 UTSW 16 35156178 missense possibly damaging 0.85
R0398:Adcy5 UTSW 16 35269068 missense probably damaging 1.00
R0457:Adcy5 UTSW 16 35274545 missense probably benign 0.07
R0554:Adcy5 UTSW 16 35294017 missense probably benign 0.26
R0698:Adcy5 UTSW 16 35290082 missense possibly damaging 0.78
R0761:Adcy5 UTSW 16 35270825 splice site probably benign
R0865:Adcy5 UTSW 16 35274471 missense probably damaging 0.96
R0927:Adcy5 UTSW 16 35156243 missense probably benign 0.32
R0945:Adcy5 UTSW 16 35290111 missense probably benign
R1534:Adcy5 UTSW 16 35253259 missense possibly damaging 0.92
R1565:Adcy5 UTSW 16 35268957 missense probably damaging 1.00
R1721:Adcy5 UTSW 16 35298424 missense probably damaging 1.00
R1839:Adcy5 UTSW 16 35248940 missense probably damaging 1.00
R2047:Adcy5 UTSW 16 35290108 missense possibly damaging 0.78
R3052:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R3053:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R3827:Adcy5 UTSW 16 35290097 missense probably benign 0.03
R4398:Adcy5 UTSW 16 35268993 missense probably damaging 1.00
R4700:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R4965:Adcy5 UTSW 16 35278502 missense possibly damaging 0.82
R5229:Adcy5 UTSW 16 35269070 missense probably damaging 0.99
R5456:Adcy5 UTSW 16 35298522 missense probably damaging 1.00
R5586:Adcy5 UTSW 16 35157116 missense probably damaging 0.99
R5959:Adcy5 UTSW 16 35298410 missense probably damaging 1.00
R6011:Adcy5 UTSW 16 35157228 missense probably benign 0.05
R6277:Adcy5 UTSW 16 35289526 missense probably benign 0.02
R6296:Adcy5 UTSW 16 35303710 missense probably damaging 1.00
R6379:Adcy5 UTSW 16 35293999 missense probably benign 0.13
R6431:Adcy5 UTSW 16 35279237 missense probably damaging 1.00
R6685:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R6728:Adcy5 UTSW 16 35157165 missense possibly damaging 0.88
R6755:Adcy5 UTSW 16 35303634 missense possibly damaging 0.95
R6887:Adcy5 UTSW 16 35298590 missense possibly damaging 0.74
R7029:Adcy5 UTSW 16 35299648 missense probably null 0.91
R7047:Adcy5 UTSW 16 35267215 missense probably damaging 1.00
R7050:Adcy5 UTSW 16 35303700 missense possibly damaging 0.88
R7102:Adcy5 UTSW 16 35299625 missense probably damaging 1.00
R7150:Adcy5 UTSW 16 35298534 missense probably damaging 1.00
R7242:Adcy5 UTSW 16 35156835 missense probably damaging 1.00
R7387:Adcy5 UTSW 16 35272090 missense probably damaging 1.00
V7732:Adcy5 UTSW 16 35283541 missense probably benign 0.00
X0022:Adcy5 UTSW 16 35299456 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTTCCTTAGGTAGGCTGCC -3'
(R):5'- TTCAAAAGACTGGGGCTCC -3'

Sequencing Primer
(F):5'- GCAGGCTCAGTCATGCTG -3'
(R):5'- GAAGGTCTCAATGCTGTG -3'
Posted On2017-12-01