Incidental Mutation 'R5734:Gpt2'
ID501400
Institutional Source Beutler Lab
Gene Symbol Gpt2
Ensembl Gene ENSMUSG00000031700
Gene Nameglutamic pyruvate transaminase (alanine aminotransferase) 2
SynonymsALT2, 4631422C05Rik
MMRRC Submission 043348-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R5734 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location85492576-85527560 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85523256 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 456 (S456P)
Ref Sequence ENSEMBL: ENSMUSP00000034136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034136] [ENSMUST00000132932]
Predicted Effect probably benign
Transcript: ENSMUST00000034136
AA Change: S456P

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034136
Gene: ENSMUSG00000031700
AA Change: S456P

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
Pfam:Aminotran_1_2 110 510 6.3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132932
SMART Domains Protein: ENSMUSP00000115968
Gene: ENSMUSG00000031700

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
PDB:3IHJ|A 48 148 6e-63 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143846
Meta Mutation Damage Score 0.1252 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial alanine transaminase, a pyridoxal enzyme that catalyzes the reversible transamination between alanine and 2-oxoglutarate to generate pyruvate and glutamate. Alanine transaminases play roles in gluconeogenesis and amino acid metabolism in many tissues including skeletal muscle, kidney, and liver. Activating transcription factor 4 upregulates this gene under metabolic stress conditions in hepatocyte cell lines. A loss of function mutation in this gene has been associated with developmental encephalopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypoactivity, reduced postnatal brain growth, various metabolic defects in pathways involving amino acid metabolism, the TCA cycle and neuroprotective mechanisms, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,703,883 probably benign Het
4931429L15Rik A G 9: 46,304,005 probably benign Het
Abcc9 A G 6: 142,625,731 probably benign Het
Adamts2 G A 11: 50,788,667 G825R probably damaging Het
Adgre1 A T 17: 57,443,990 R555W probably benign Het
Apob T A 12: 7,988,781 V398D probably damaging Het
Arid4b A G 13: 14,160,271 N355S probably benign Het
Asb3 G T 11: 31,029,021 D143Y probably damaging Het
Birc6 G A 17: 74,618,424 probably benign Het
Cacna1a A G 8: 84,583,731 M1425V probably damaging Het
Capn9 A G 8: 124,605,844 E474G probably damaging Het
Capza2 T C 6: 17,660,765 S155P probably damaging Het
Ccdc125 A G 13: 100,687,114 N202S possibly damaging Het
Chrm5 T A 2: 112,480,100 T224S probably benign Het
Chtop C T 3: 90,502,115 probably null Het
Clip1 T C 5: 123,615,154 probably benign Het
Cyr61 A G 3: 145,648,268 C256R probably damaging Het
Dbx2 T C 15: 95,654,723 T14A possibly damaging Het
Dcaf8 T C 1: 172,172,911 V212A possibly damaging Het
Fam114a1 T C 5: 65,009,046 M240T probably damaging Het
Fat1 T C 8: 45,051,209 Y4580H probably damaging Het
Glipr1 G A 10: 111,985,793 R200* probably null Het
Gm6408 A T 5: 146,482,382 Y69F probably benign Het
Kat8 T C 7: 127,920,579 F225S probably benign Het
Lactb2 T A 1: 13,660,387 N22Y probably damaging Het
Lin28a A T 4: 134,007,973 C67* probably null Het
Marc2 T C 1: 184,832,589 E155G probably benign Het
Myoz3 G A 18: 60,579,471 T104M possibly damaging Het
Nek9 C T 12: 85,303,515 M928I probably benign Het
Nlrp9a G C 7: 26,570,640 A831P probably damaging Het
Nop53 T C 7: 15,945,962 probably null Het
Ofcc1 T A 13: 40,087,849 T728S probably damaging Het
Pabpc4l T A 3: 46,446,689 probably null Het
Rbm34 T C 8: 126,970,130 probably null Het
Robo2 C T 16: 74,352,784 C52Y probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Scn2a A G 2: 65,717,722 Y57C possibly damaging Het
Selp C T 1: 164,143,891 probably benign Het
Skp2 T C 15: 9,139,479 D43G possibly damaging Het
Smad5 T A 13: 56,723,804 S71T probably damaging Het
Sorcs1 G T 19: 50,182,775 H892N probably benign Het
Sox6 C T 7: 115,541,621 probably null Het
St3gal1 A T 15: 67,106,673 I333N probably damaging Het
Tex15 C A 8: 33,546,336 Q97K probably benign Het
Tnxb A T 17: 34,698,910 T2266S possibly damaging Het
Tpbgl C A 7: 99,625,742 G303C probably damaging Het
Trat1 A T 16: 48,734,941 S143T possibly damaging Het
Trpm8 T A 1: 88,355,280 V763E probably benign Het
Ttc21a G A 9: 119,966,666 D1189N probably benign Het
Usp7 T C 16: 8,701,981 N178D possibly damaging Het
Zfp217 T C 2: 170,119,144 D421G possibly damaging Het
Zfp382 T C 7: 30,134,430 F502S probably damaging Het
Other mutations in Gpt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Gpt2 APN 8 85512324 missense probably benign
IGL01611:Gpt2 APN 8 85519538 nonsense probably null
IGL02385:Gpt2 APN 8 85516153 splice site probably null
IGL02484:Gpt2 APN 8 85516233 missense probably damaging 1.00
IGL02589:Gpt2 APN 8 85516166 nonsense probably null
IGL02669:Gpt2 APN 8 85523279 missense probably benign 0.02
R1191:Gpt2 UTSW 8 85509272 missense probably damaging 1.00
R1599:Gpt2 UTSW 8 85512234 missense probably damaging 1.00
R1944:Gpt2 UTSW 8 85517996 missense probably damaging 1.00
R1953:Gpt2 UTSW 8 85521384 missense probably benign 0.00
R1962:Gpt2 UTSW 8 85493135 missense probably damaging 0.99
R1982:Gpt2 UTSW 8 85516203 missense possibly damaging 0.75
R2283:Gpt2 UTSW 8 85516189 missense probably benign
R3785:Gpt2 UTSW 8 85525573 missense probably benign
R3786:Gpt2 UTSW 8 85525573 missense probably benign
R3787:Gpt2 UTSW 8 85525573 missense probably benign
R4402:Gpt2 UTSW 8 85525559 missense probably benign 0.32
R4974:Gpt2 UTSW 8 85519439 splice site probably benign
R5457:Gpt2 UTSW 8 85512338 missense possibly damaging 0.90
R5589:Gpt2 UTSW 8 85493111 missense probably damaging 1.00
R5924:Gpt2 UTSW 8 85493004 missense probably damaging 1.00
R6371:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6651:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6652:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6895:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6898:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6923:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6955:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6956:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7112:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7113:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7115:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7124:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7125:Gpt2 UTSW 8 85518052 missense probably benign 0.03
X0058:Gpt2 UTSW 8 85518019 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TTTGAGCCCTTCACGCCAAG -3'
(R):5'- AGTCTCTAAAGCAAGAACTCAAGGG -3'

Sequencing Primer
(F):5'- TATTTATAGCCCAGGTGAGACCC -3'
(R):5'- GCAAGAACTCAAGGGACCAAC -3'
Posted On2017-12-01