Incidental Mutation 'R5772:Garre1'
ID 501404
Institutional Source Beutler Lab
Gene Symbol Garre1
Ensembl Gene ENSMUSG00000066571
Gene Name granule associated Rac and RHOG effector 1
Synonyms 4931406P16Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5772 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 33936132-34012976 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 33953413 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 238 (W238R)
Ref Sequence ENSEMBL: ENSMUSP00000145762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085592] [ENSMUST00000105172] [ENSMUST00000108074] [ENSMUST00000206399]
AlphaFold Q8C5X1
Predicted Effect probably damaging
Transcript: ENSMUST00000085592
AA Change: W450R

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082730
Gene: ENSMUSG00000066571
AA Change: W450R

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:DUF4745 59 187 1.3e-57 PFAM
low complexity region 319 332 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
low complexity region 677 696 N/A INTRINSIC
low complexity region 699 729 N/A INTRINSIC
low complexity region 771 786 N/A INTRINSIC
low complexity region 856 868 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 940 951 N/A INTRINSIC
low complexity region 1026 1049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105172
SMART Domains Protein: ENSMUSP00000100805
Gene: ENSMUSG00000078380

DomainStartEndE-ValueType
Pfam:Ribosomal_L23eN 13 62 1.1e-20 PFAM
Pfam:Ribosomal_L23 70 142 6.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108074
AA Change: W450R

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103709
Gene: ENSMUSG00000066571
AA Change: W450R

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
low complexity region 677 696 N/A INTRINSIC
low complexity region 699 729 N/A INTRINSIC
low complexity region 771 786 N/A INTRINSIC
low complexity region 856 868 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 940 951 N/A INTRINSIC
low complexity region 1026 1049 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205581
Predicted Effect probably damaging
Transcript: ENSMUST00000206399
AA Change: W238R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207005
Meta Mutation Damage Score 0.8048 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932416K20Rik G A 8: 105,524,271 (GRCm39) noncoding transcript Het
Abcg8 A T 17: 84,994,127 (GRCm39) E48V probably damaging Het
Afap1l2 T C 19: 56,911,406 (GRCm39) T289A probably benign Het
Atf6 T A 1: 170,574,758 (GRCm39) D560V probably damaging Het
Bcl2l14 A T 6: 134,404,362 (GRCm39) K183N probably damaging Het
Carmil3 T C 14: 55,730,696 (GRCm39) L52P probably damaging Het
Cct3 T A 3: 88,208,274 (GRCm39) N61K probably damaging Het
Col18a1 A G 10: 77,002,177 (GRCm39) V10A unknown Het
Col26a1 G A 5: 136,876,420 (GRCm39) Q67* probably null Het
Cyp2d34 T C 15: 82,501,341 (GRCm39) D329G probably null Het
Dchs1 T A 7: 105,422,247 (GRCm39) I58F probably damaging Het
Ddx60 T C 8: 62,401,931 (GRCm39) L269P probably damaging Het
Dis3l2 G A 1: 86,806,154 (GRCm39) G325D probably damaging Het
Dync1h1 A T 12: 110,612,707 (GRCm39) K2861* probably null Het
Ednra A G 8: 78,401,696 (GRCm39) I198T possibly damaging Het
Ep300 T C 15: 81,524,115 (GRCm39) probably benign Het
Fam120a G A 13: 49,034,409 (GRCm39) P1068S probably benign Het
Fsip2 A T 2: 82,815,084 (GRCm39) M3606L probably benign Het
Gm7713 T C 15: 59,866,492 (GRCm39) noncoding transcript Het
Gprin3 A T 6: 59,331,398 (GRCm39) V303D possibly damaging Het
Hmcn1 A T 1: 150,570,629 (GRCm39) V2178D possibly damaging Het
Hoxa11 A G 6: 52,222,380 (GRCm39) V107A possibly damaging Het
Iqub C A 6: 24,454,250 (GRCm39) M544I possibly damaging Het
Itgb4 A T 11: 115,879,258 (GRCm39) probably benign Het
Itpkb A G 1: 180,161,818 (GRCm39) probably benign Het
Kalrn A T 16: 33,796,190 (GRCm39) V1195E probably damaging Het
Kif12 C A 4: 63,084,178 (GRCm39) R608M probably damaging Het
Lcorl A T 5: 45,952,709 (GRCm39) probably null Het
Lrrc24 T C 15: 76,606,910 (GRCm39) E162G probably damaging Het
Med6 A G 12: 81,626,418 (GRCm39) S119P probably damaging Het
Mmab A C 5: 114,574,775 (GRCm39) L166R probably damaging Het
Myef2l A G 3: 10,153,566 (GRCm39) R112G probably damaging Het
Nom1 A G 5: 29,651,873 (GRCm39) K737R possibly damaging Het
Obscn T C 11: 58,946,970 (GRCm39) S4352G probably damaging Het
Or10ag60 A T 2: 87,438,517 (GRCm39) T262S probably benign Het
Or2w25 T A 11: 59,504,712 (GRCm39) D307E probably benign Het
Or4k35 A T 2: 111,100,057 (GRCm39) Y218* probably null Het
Or6d12 A C 6: 116,492,912 (GRCm39) D58A possibly damaging Het
Pdzrn3 G A 6: 101,149,275 (GRCm39) S351L probably benign Het
Pdzrn4 A T 15: 92,655,562 (GRCm39) E485V probably damaging Het
Prkdc T A 16: 15,597,252 (GRCm39) I2804K possibly damaging Het
Psg28 A G 7: 18,164,640 (GRCm39) L24P probably damaging Het
Resp18 A G 1: 75,250,644 (GRCm39) V145A possibly damaging Het
Rgl3 T C 9: 21,892,908 (GRCm39) M259V probably benign Het
Rhot2 A T 17: 26,058,781 (GRCm39) S540T probably benign Het
Ring1 T C 17: 34,241,282 (GRCm39) Y278C possibly damaging Het
Rpn2 A G 2: 157,137,265 (GRCm39) Y216C probably damaging Het
Scgb2b18 G A 7: 32,873,255 (GRCm39) L5F unknown Het
Slamf7 T C 1: 171,466,838 (GRCm39) probably null Het
Slc22a12 T C 19: 6,590,479 (GRCm39) N237S possibly damaging Het
Spen A T 4: 141,205,495 (GRCm39) V1044D unknown Het
Sqor A T 2: 122,651,261 (GRCm39) M175L probably benign Het
Stx16 G A 2: 173,935,292 (GRCm39) G156R probably damaging Het
Tars3 T G 7: 65,333,873 (GRCm39) F632V probably damaging Het
Tln1 A G 4: 43,545,191 (GRCm39) V1008A probably benign Het
Tmem145 A G 7: 25,015,039 (GRCm39) H554R probably benign Het
Trank1 A T 9: 111,195,744 (GRCm39) D1256V possibly damaging Het
Trbv19 A G 6: 41,155,794 (GRCm39) Y55C possibly damaging Het
Ttc23l C T 15: 10,551,555 (GRCm39) C57Y probably benign Het
Uap1 A T 1: 169,988,949 (GRCm39) C158S probably benign Het
Zfp353-ps T A 8: 42,535,647 (GRCm39) noncoding transcript Het
Zfp629 T A 7: 127,210,307 (GRCm39) I501F probably damaging Het
Zfp820 T C 17: 22,037,702 (GRCm39) Y542C probably damaging Het
Other mutations in Garre1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Garre1 APN 7 33,945,412 (GRCm39) splice site probably benign
IGL00160:Garre1 APN 7 33,938,431 (GRCm39) missense possibly damaging 0.88
IGL00691:Garre1 APN 7 33,944,910 (GRCm39) missense probably damaging 1.00
IGL01312:Garre1 APN 7 33,955,933 (GRCm39) missense probably benign 0.19
IGL01954:Garre1 APN 7 33,944,460 (GRCm39) missense probably damaging 1.00
IGL02016:Garre1 APN 7 33,938,526 (GRCm39) missense possibly damaging 0.74
IGL02390:Garre1 APN 7 33,947,643 (GRCm39) missense probably damaging 1.00
IGL02407:Garre1 APN 7 33,955,909 (GRCm39) missense probably damaging 0.99
IGL02677:Garre1 APN 7 33,941,834 (GRCm39) splice site probably benign
IGL02929:Garre1 APN 7 33,944,507 (GRCm39) missense possibly damaging 0.46
IGL03285:Garre1 APN 7 33,984,416 (GRCm39) missense possibly damaging 0.81
I1329:Garre1 UTSW 7 33,944,619 (GRCm39) missense probably benign 0.00
R0004:Garre1 UTSW 7 33,955,853 (GRCm39) missense probably damaging 0.99
R0100:Garre1 UTSW 7 33,953,436 (GRCm39) missense possibly damaging 0.95
R0100:Garre1 UTSW 7 33,953,436 (GRCm39) missense possibly damaging 0.95
R0135:Garre1 UTSW 7 33,945,382 (GRCm39) missense probably damaging 1.00
R0137:Garre1 UTSW 7 33,938,644 (GRCm39) missense probably damaging 1.00
R0556:Garre1 UTSW 7 33,939,222 (GRCm39) missense probably damaging 0.99
R0687:Garre1 UTSW 7 33,944,843 (GRCm39) missense possibly damaging 0.95
R0928:Garre1 UTSW 7 33,947,671 (GRCm39) splice site probably null
R1719:Garre1 UTSW 7 33,947,631 (GRCm39) missense probably damaging 0.98
R1908:Garre1 UTSW 7 33,957,461 (GRCm39) missense probably benign 0.14
R1909:Garre1 UTSW 7 33,957,461 (GRCm39) missense probably benign 0.14
R1976:Garre1 UTSW 7 33,956,805 (GRCm39) missense probably damaging 0.99
R2496:Garre1 UTSW 7 33,955,916 (GRCm39) missense possibly damaging 0.93
R3005:Garre1 UTSW 7 33,984,209 (GRCm39) missense probably damaging 1.00
R4666:Garre1 UTSW 7 33,984,198 (GRCm39) missense probably damaging 0.98
R4832:Garre1 UTSW 7 33,938,333 (GRCm39) utr 3 prime probably benign
R4870:Garre1 UTSW 7 33,984,312 (GRCm39) missense possibly damaging 0.83
R4989:Garre1 UTSW 7 33,945,225 (GRCm39) missense probably damaging 1.00
R5033:Garre1 UTSW 7 33,945,237 (GRCm39) missense probably benign
R5308:Garre1 UTSW 7 33,945,180 (GRCm39) nonsense probably null
R5366:Garre1 UTSW 7 33,941,713 (GRCm39) missense possibly damaging 0.74
R5386:Garre1 UTSW 7 33,941,813 (GRCm39) missense probably damaging 0.99
R5688:Garre1 UTSW 7 33,984,134 (GRCm39) missense probably damaging 0.99
R5688:Garre1 UTSW 7 33,953,416 (GRCm39) missense possibly damaging 0.74
R5714:Garre1 UTSW 7 33,939,941 (GRCm39) nonsense probably null
R5733:Garre1 UTSW 7 33,944,505 (GRCm39) missense probably damaging 0.99
R6059:Garre1 UTSW 7 33,944,888 (GRCm39) missense possibly damaging 0.90
R6211:Garre1 UTSW 7 33,938,429 (GRCm39) missense possibly damaging 0.95
R6276:Garre1 UTSW 7 33,941,802 (GRCm39) nonsense probably null
R6477:Garre1 UTSW 7 33,957,055 (GRCm39) critical splice donor site probably null
R6757:Garre1 UTSW 7 33,938,502 (GRCm39) missense possibly damaging 0.89
R6912:Garre1 UTSW 7 33,945,093 (GRCm39) missense probably benign
R7156:Garre1 UTSW 7 33,945,133 (GRCm39) missense possibly damaging 0.80
R7317:Garre1 UTSW 7 33,963,072 (GRCm39) missense probably benign
R7431:Garre1 UTSW 7 33,984,219 (GRCm39) missense possibly damaging 0.73
R7452:Garre1 UTSW 7 33,945,096 (GRCm39) missense probably benign
R7996:Garre1 UTSW 7 33,963,024 (GRCm39) missense possibly damaging 0.77
R8348:Garre1 UTSW 7 33,984,569 (GRCm39) missense probably damaging 1.00
R8448:Garre1 UTSW 7 33,984,569 (GRCm39) missense probably damaging 1.00
R8989:Garre1 UTSW 7 33,956,869 (GRCm39) missense probably damaging 0.99
R9010:Garre1 UTSW 7 33,938,491 (GRCm39) missense probably benign 0.01
R9095:Garre1 UTSW 7 33,956,770 (GRCm39) critical splice donor site probably null
R9505:Garre1 UTSW 7 33,984,371 (GRCm39) missense probably damaging 1.00
R9530:Garre1 UTSW 7 33,963,069 (GRCm39) missense probably benign 0.01
R9612:Garre1 UTSW 7 33,947,656 (GRCm39) missense probably damaging 1.00
RF019:Garre1 UTSW 7 33,939,974 (GRCm39) missense probably damaging 0.98
X0021:Garre1 UTSW 7 33,944,788 (GRCm39) missense possibly damaging 0.94
Z1177:Garre1 UTSW 7 33,984,180 (GRCm39) missense probably damaging 0.96
Z1186:Garre1 UTSW 7 33,945,185 (GRCm39) missense probably benign
Z1186:Garre1 UTSW 7 33,938,583 (GRCm39) missense probably benign 0.03
Z1186:Garre1 UTSW 7 33,938,533 (GRCm39) missense probably benign
Z1191:Garre1 UTSW 7 33,945,185 (GRCm39) missense probably benign
Z1191:Garre1 UTSW 7 33,938,583 (GRCm39) missense probably benign 0.03
Z1191:Garre1 UTSW 7 33,938,533 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTATATGCCAGTTGCCTGTGG -3'
(R):5'- AGACAGTTCTGCCGGTTACTG -3'

Sequencing Primer
(F):5'- GGTCAAAGGAGCTCTTTCTCAG -3'
(R):5'- CCGGTTACTGAGTGACTAATACGC -3'
Posted On 2017-12-01